Microcebus_murinus Locus Mono:231:SNORA74
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:231:SNORA74
Microcebus_murinus
Mono:231:SNORA74
GeneScaffold_1311
SNORA74
1001..1192
2192
TTTTGAAATAATTTCAAACTTACAGAGAAGCTGCAAGAATTGACAAAGAGCTCTCAGAT
ACTCTTTGCTCAGATCCACCAACTGTTAATGTTTGGCCATGTTAGCTCTATCATTCCCTC
TTTCATGCTCTATCATTCTCTTTCAAGTCTCAGACCTGTTTTTTAAAATCTCTATTCAAC
TTCTTTATTGTCCATTTCCATTTCGTGCCTTATATTAGTTGCCTTTTCTTTCTGAATTCA
CTGATTTTCATTCCTTAACAGAAAAGGGAAGATAGGAAGTAAAAAGGATAAGATGAACTT
ATTAACCATCAGGTTTTTCATCCATTTAAAGCTATGAGATTCATTTTGAGACAATAAGGA
AGGCATTTAACATGTCTATGAATATGGTCAAGCCAGAAAAAAAAGGGAGCCATCTTCTAG
AATAGACTATTTTTAGTAGCAGAATTAATGTGGAAAAGAATTGCGGTGCATACATAAATA
GCTCTTCCTGGGAGCATAATGATAACTCTGGTTCTGCTATTTACAAAATCAGCCAAGAAA
GGTTTGGGGAAATCTATTGTATTAGCAAAAGGAGAATTTTCATACTGGTATAAGTGACTA
ATAATATTTAAGAAGAACTTGGCTTGTCATTTATTATAGAGGATGTGGGTGTGTTTTAGA
GAGAATGGAGGTGCATCTTCATATCACACAGGGCACTTGTGCAAATTCTACCAGTCCACA
CAGAAATTCTTCTTCTTCTGACTTTAGCCCACGCTGACTCTCATATATTGAGTCATGTCA
TTTCACTTTAAGGAAGTGCTAAGTGAAATCAATGAAACAGCTGAACATTGATGAGTTCCA
AGAATTGCAACATACTGAATAAAAAGAATAATGGAATCATTCATGGAAGAGGTCATTCAT
AAACAGCTTAGTTTCACTGTAGTAAAAAAAAAAAAAAAAAGAAAGAAAAAAAACAGAGTG
AAAGGAAAGTGTAGCTCAGGATTCTGGATTTAAAAATGTTATCCAGCAGTTGCCAGCCCT
CCAGGCTGGTGCCATGCATGTGATGATGTTGCACTGTTGGAAGAGCCAGTGTTGAGGTTT
GGCTCCACCCACTGTTTTGGTGTTGCAGGAAAATACCTTTGAGCAATGTTTTACACCTCT
GAGAGGGGAATGACTCCTCCTGTGGAACTGGTCCCAGTCTGGGTGCAAACAATATTTTCT
GTTAAAAAAAGAACTTTGAGTTAAGTTTCATTTCTGGCCTATTAAAGTTCTCATTATAGA
TTCTTTTGCTTAAGAGATACAACCAAGGTGTGCCTATTCATTCAATGCATTTGTTCCAGA
AATATTTTTTGTATGCCAGGCCCCATATTGGGCCAGGCACTGTTCTAGTCACACGGCATG
TAACAGCAAGCAAAACACCCCTATCCTCACCAAGCTGATATTCAAATGGAGGAGACAGAC
AATAAATGTACCAAATGAGGAAATCAGGAAGTGTGTCAGCAGGTGGTGAGTGCTATAGGG
AAATGGGAGGGCAGGCAGAAGGATCCAACGTGTGTGGAGAAGCAGGTTGCAATCTTAAGG
GTAGGCTTTGTTGAGAAGTAACTTCAAGCAAAGGTTTGAAAAAGGTGCAAATGATTGGGG
GAGGAGCATTCCAGGAAGCAGTAACACCTGGTACAGAGTCCCAGGAAACCAGGAGCATCT
TGGCTTATTCCAGAAACAACAAGAGTGACCAGGGGCATAGTGAGCCAGGAGGGAAGTGCA
AGCAGGTCAGGTAGGGCCTGGGCTGTGGAAGGATTTCAGCTTCCACTCCTTCCTTGTTCA
CTCTGCATGATACAGCTTTTGAGCAGAGAAGGAACTCCATTTGACGTTCATTTTAAAAGG
GTGTCTCTGGCTCCTCTGTTGAGAATAAACAGCAGGGGACGAGGCAGAAGCAGGGTGACC
AGTTGGGAGCCCACTGTACTGACCCAGGCGAGGGCTGGTCAGGGTTCAGCCCAGGATGTA
GAGTGGCAGTGGTGAAAAGGGACCACATTCTGGATGTGTTCTGCAGACAGAAAAAAGCAG
GATTTCCAGGTGGATGGGATGTGAGCTGGGAAAGAGAAGAGTCAAAGTGACTCCAAGGTT
TTGGACTCAAAACAACTACAAAAAATGGAGTTGTCATCAACTGACGTGCGGAAGCTGCTG
GTGGAGCAGGCTTGGAGGTGGGCGGATCAGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved