Microcebus_murinus Locus Mono:189:SNORA26
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:189:SNORA26
Microcebus_murinus
Mono:189:SNORA26
GeneScaffold_3327
SNORA26
1001..1123
2123
AACAAAATATTAATTGTAGAATTTAGGAAGTAGGTATATAGGTGTTCAAGGGATAGTTC
TTTCAACTTATTTTGAAAATTTCATAATAAAATAAATGTTGGAAAAACAGTTATGTACAT
CCACACAACAAAATATTCTACATTTGTGATCGAAAAAAAGCATGTATGAGTGTGCCTTCC
TCATTCAAGTCTCGTCCTTCTCTCTAAAAACACAACAGTCAGATGTGTGGAGCTCATTAT
GGAAGTTCATCCGTTCTACCCCACTGTTTTCGGTGAGTGCAGGGTGCAGCTGGATGTGTC
ATGATTTATTTTACCAGTTTCCTATTGGGGAGTATTGTTTCCAGTTTGTAAATAAATGAT
GCTGCATTTAACGTCCTTATTACAAGGAACTGCTGGGTCAAAAGACATACGCATTTTAAA
CTTTTACTATTACTGCCCAAATGCTCTCCAAAAAAATTGCACTGTTAAGAACAGTTTTTG
ACAGCACCTATTTTCCTACAACTGTACCAACCCTGGGTCTCAAGCTTTAATTTCTACCAG
TGGAAGAAAATGATATCTCATTGTTTTAATTGCTTTAAATATGGGTAAAGCTCAACATCT
TTACATAGGTATTTTATTAAGACTAGTCAAGTAGTGAGAAGGGGGTAAAGTAGTAGAACA
AGGAGTTCAATCTGTAACTGTGAATAATCAAGTGAGATAACTCACTACCTTCAGATCAGC
CAACATAAGGTCTTTTTTAATCTATGGAATCAAATTTCTCTAACTTTTCCTTCAATGACT
TCTGTGAGTTAATTTCCTCCATATAAGAATACTTTCCCCAGGCCGGGTGCGGTGGCTCAC
ACCTGTAATCCTAGCACTTTGGGAGGCAGAGGGAGGGGGATCGCTCAAGGTCAGGAGTTT
GAAACCAGCCTGAGCAAGAGTGAGACCCCATCTCTACTAAAAATAGAAAGAAATTAATTG
GCCAACTAAAAATATGTAGAAACAAAATTAAGCCCTTTCCTGTGTCCTTTTAAAGTTGAC
GCAGTGCTTTAAGAGGCTAACACAGAAGGGTAAAGTAACTCTCCATAAAACCCAGAGAAG
AGATTTTTAAAACTCTTCTTTGGATCCTGTCTGGAGTCACAGCTGAACTAGAAAAAAAAA
AAAAAAATTAGCCGGGCATGGTGGCACATGCCTGTAGTCCCAGCTACTCGGGAGACTGAG
GCAGAAGGATCGCTTGAACCCAGGAGTTTGAGGCTGCTGTCAGCCAGGCTGATGCCATGG
CACTCTAGCCCCAACAACAGAGTCAGAGACTGTCAAAAAAAAGAATACTTTCCCCATTGC
AAGATAATTAGCCCACATGTTCTCTCAGAACTTAATGGTTTTACTGTTTACATCTGAAAC
TGTAATCCACTTATAATTTATTTTATTTATTTATTTTTTGAGACAGAGTCTCGCTTTGTT
GCCCAGGCTAGAGTGAGTACTGTGGTGTCGGCCTAGCTCACAGCAACCTCAAACTCCTGG
GCTCAAGCAATCCTACTGTCTCAGCCTCCTGAATGACTGGGACTACAGGCATGCGCCACC
ATGCCCAACTAATTTTTTCTATATATATTAGTTGGCCAATTAATTTCTTCCTATTTATAG
TAGAGACGGGGTCTCGCTCTTGCTCAGCCTGGTTTCGAACTCCTGACCTCGAGCAATCTG
CCTGCTTCGGCCTCCCAGAGTGCTGGGATTAAAGGCGTGAGCCACTGTGCCCTGCCCTAG
AATTTATTTTAAAATAACAATTGGGTACACCAGGAACTGTGTAAAGGATAAAACAAATTA
AATAATAATTAAAAAAAAGAACTGAGGTAGGATTCAGGTTTATTTTTCACTGTTACCCAG
CCAATCCAATATCATTTATTGAATAATCCCCCCCCCCATACTTTATCATACACTAAATTC
TCTTCTGCTGTTGTTCTCATTTTTTCCTGACAAACTTTGGAACCACTATCATTAGTAGAA
TTTAAAAATTCTACTAGTCTTTTGTGATTGCATAGGATTTATATTATAAATTAACTTAGA
GAAAAGCTACATCCTTGTAGCAATTTAAAGACAGGTACAAATTCTTTGGTGCTCTTCCCA
TTGAAAGGTGGAGGGCTTTCTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved