Microcebus_murinus Locus Mono:14:SNORA68
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:14:SNORA68
Microcebus_murinus
Mono:14:SNORA68
scaffold_657
SNORA68
1001..1135
2135
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTCTTAGTCATTCAGACTCTAA
AGTTTGGTGTCACAAATGTCTTCTTTGTCCTCCCAGATCTTTCGTTTTTGGTCACCCAGA
TTGATAAATGTGAACAACGTTTGTCAATACTTTCTTCAAAATGTCTCTTGAAGAATCCCA
TCACCTTTGGGGAGCTGTGGCAGGCCCCTCAAAGTGAATTTGGAGGTTCTACACCACTTA
TGGTCAGTTCCTGCTGGGACCAGAGGCTGTGGCCGGCCAGTCCCTCAGTCAACCCCAAGT
TGAGGTCCCCAGGCAATGCCTGTGCCTGACAGGATGTGCCATGTCATTGGGCAGGCACTT
GATAGGAGGTTTGCCAAAGGCCCAGATCCAGTGAATGCAGTCACTGTGTCCTCTCCTTCT
TTGTGCAGACCAAGACATGTGGCCAGGTCCACTCAGTACAGATCATGAAGATGGAGGAGG
TCACAGCCAGCAAGTGCCACTGTCCAGCATTCAAGAGGTTCCAGACTCCAAGATCCAGTT
CTCACTGTCTCACTAGGTCCTGTATTACTAAGATGAGCCATGCGTCACCACCACCTTCTT
TTCGGTATAAGACCCTGTCACTCCAGGTCTTCCCAAATAACCTCTTCAGGAATACCAAAA
ACAAAACCAAATGCAACAACATCCACATGTCTCCTGATTCCATTTCTTTCTCCAATTCTC
CCTTCTACCAGTGCCCCCACTGTTGCTGAGTTTCTTACCATCTTTCTCTATTTCTCCTAT
TATAGAAGCTTTTCAATTTTAATTATCCACCCACTTCTAGTCTCTCTTCTTGCCAATTCA
TCATTCACATTGCTGACAAGTTGGTCATAAAACACTCTTTCGGTGTTGTCATTCCCCCAC
TTGAAGACTTCAGTGACTCCCCACAGCCTACAGAAGTCCAAATGGCTGATTCTGACAGTG
TAAGACCTTGACCATCACTGTGACCTTTGAAGACAGCTCTAACGATTCACTTCATCAGCC
ATGTACTCCAGCTACACTCTGCTCTAACCTGCCTTGAACTTTTCTAATTTTATGCTTTTG
CTTAAACCAATCCTGCTGGCCTGGAATGCACTCCTTTGTCTCTGCCTCTGTAAATCCCAT
CCATCACTCAAGTCACAGTGCAAGTCCCCTCTCCTTTGTGAAGCCTTCCAAATTCAGGCC
AGCCCATGTGATCCTATATTCCTCTGAATTAGTATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved