Microcebus_murinus Locus Mono:147:SNORA36
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:147:SNORA36
Microcebus_murinus
Mono:147:SNORA36
scaffold_26056
SNORA36
1001..1129
2129
ACGTTTATGAATGGTAATTAGGTAAATGAAGCTTACTTTCTTGGTTGCCAAATATTTAT
TGCTGTCGTCATTGCTGGTTTTAGCTCTTTTTGGCTAAAAATATTCCAGAAAAATTATAC
ATTTCTTATCTATTTAGAAAGTGGCAAAAATATGATTTCAGCTGAGAAAAGTTCAGGATT
GTCACTACACTACATTTGTTAGGCTAACTGAAAAAAAAATGCTTCAAAAATAAACATTTT
AAGATGAGTTAAATAGAATGAAACACAAAATAATAAGAAATAAATTGAAGAGAAGGTCTG
CCAGATCTTCACACTGAAAATTACAAAACATAAAGAAACCTAAATACATGGACAGACATA
CTTTGTTTATACATCAAGACTCTGTATTAATAAGCTATCATTTTTTCCCAATTTAGTCAA
TTGAATTACAGATTGATTAAATTACACTGAAAATCTTAGAAGTTTTTTTTTAAAAAACCT
GAAAAACTGATTCCAAAATTTATATAGAACTATAAAGACCTGTAATAGTCTTGAAAAAGA
ATAATGAAGTTGGAGGGCTGACATTACATGATTTTGAGATTTACTATAAAGCTGTTGTAA
TTAAGACAATGTAGCATTGACAAAAAGATTGAAAAAGATTTGTGGAAAGTGTATTATACA
AATATAGATCAAATTATATTGATCTAATAACTTTTGACATAGGTTTCAGTGTATTTCAAA
GAGAAAGGTCTTTTCAATAATTATTTCTACTTGTACGACTAGATATTAATTTTGAAAAAT
AAATAACTCTGATACATCTCTCAAACCAGATACAAAAACATACTTGAAGTACATTGCAAA
TCTAAAAGTAAAAGCTAAACTATAAAGCTCTTATAAGATAACAAAGAATGATATTTTTAC
AAATTTGGGGTAGACAACTATCCATAAAGGAAAAAAAGGTAAAACTATTACGATAAAAAA
GTTCTGATCATCAAAAACATCATTAAGAAAATAAAAAGGCTTTCAAAAGTGTTGACTTCA
GTTCAGGGAAGCTTCCCTGTTCTGATAATTAAACTTGACATTGACATGGGCTAGGGGAGA
TGACTGGATAGAATGCTTTATCTATTCATTTATCTCTTAGTCCTACAAAAATGGAATGAG
AATATGAATCAAAGGGGGAAAATAAAAGATATAAAACTTCAATCCATTCTCACTGGAGTT
AAGTGATATCTCATTGTAGTTTTGATTTGCATTTCCCTGATGATTAGAGATGATGAGCAT
TTTTTCATATGTTTGTTGGCCTTCTGTCTTCTTTAGAAAAGTTTCTGTTCAAGTCCTTTG
CCCACTTTTTAATATTCAGCTCTAAGAAACAATGGTGATATAGCACATCTTATATTTTCC
TGGTTAGAGCTGGAACCCATACTACTAAGTGAAGTATCCCAAGAATGGAAAAACAAGCAC
CACATATACTCACCAGCAAACTGGTATTAACTGAGTAGCACCTAAGTGGACACATAGGTA
CTACAGTAATAGGGTATTGGGGAGGGAGAAGGGGAGAGGGGGGCGGGTATATACATACAT
AACGAGTGACATGTGCACCATCTGAGGGATGGTCATGCTGGAAACTCAGACTTGTGGGGG
GAGGGGGGAAAGGGCATTTGTTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved