Microcebus_murinus Locus Mono:110:SNORA12
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:110:SNORA12
Microcebus_murinus
Mono:110:SNORA12
scaffold_17095
SNORA12
1001..1148
2148
GCTACCTTGCCCTGGCCAAAGGAGGCTTATCTGATGACCATGTCCTCATCCTGCCCATT
GGACACTACCAGTCAGTGGTGGAGCTTTCAGCAGAGGTGGTGGAAGAGGTGGAAAAGTAT
AAGGCTACACTGAGAAGGTTCTTTAAGAGTCGAGGGAAACGGTGTATCCTATTTGAGAGA
AATTATAAGAGCCATCACCTCCAGCTACAGGTAGGTACAGGAACAGGAACTTGGAAGGGT
ACTATGGGGATCTTAATGTTGAGAAATAAATATTTAAATAATGTTTAACTTTAATATTTA
AAATATTTAATATGAATTTAATACCTAAAATATTTAATATGGATTTTCACATTAATATTT
AAATAATGTTCATTGGAAAGGTTATTTAAAAGGTGATAACCCCAGAGATTTCATAGGGAA
ATGTGTGGTCAGTACAAGTGAATAGCACAGATAGTAAGTGCCTTGTTTAGAAAAAGAATG
GGTTTAGGCCAGGTGCAGTGGCTCACGCCTATAATCCTAGCACTCTGGGAGGCTGAGGTG
GGCGGATTGCTCAAGATCAGGAGTTCAAAACTAGCCTGAGCAAGAGTGAGACCCCATCTC
TACTATAAATAGAAAGAAATTAATTGGCCAACTAATATATATAGAAAAAATTAGCCGGGC
ATGGTGGCACATGCCTATAGTCCCAGCCACTCGGGAGGCTGAGGCAGTAGGATCGCTTGA
GCCTAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGACACCACGGCACTCTAGACTGGGCAA
CAGAGTGAGACTCTGTCTCAAAAAAAAAAAAAAAAAAAGAAGGGAAGGGAAGGGGAGGGG
AGTGGAGGGAGGGAGGAAGGGAGGAAGGGGGAAAGGAAAGGATTATAAGGAAGGGAGTCT
TTTGTTTATAGAGGCCCAAAATGAGTGAAGGCTTAGAGGTAGGAAATATCCTGCATGGAG
CTAATAGCTAAAAATATTAAGATTGTTTATAAATAATTGGTAATTGTGGTGGTTTTCTTT
CTGGCACATTTGTTAAGTTTTCAAATGGGCCTAACTCTGCCACATATATTACAGTGGAGC
TGGCAAAGGCTTGGTGACAAAGAGATCTCTCTTAAGCCTTTTCTGCATCAGAGATTGGCT
CCCACATGTGGCAGGCTATCTCATAAGTTTAAGTCCTTACAGACAAGCTGACACAGGCTT
GTCTGGCTTGAGGAGAGTCTATGCTGAGGGGTGTCTCTCTACCCCTGTGATGGATTTGCT
ACTTCTCAGAGATTGTGCAGATACAGCCTCTCTGGGAACTGCACAAAGAACTTCTCCTTT
TCTCCCCCCAACCCCTCTAGGTCATTCCTGTGCCACTCAGCTGCTGCGCTACTGATGACA
TTAAAGATGCCTTCATTACCCAGGCACAGGAGCAACAGATAGAGCTGTTAGAAATACCAG
AGCACTCTGACATCAAACAGGTGAAATCAGAGGGGATGGTGATGTTCAGGGAGGAGTAAA
AGTCTGGTGTTTGACATGTCGAATCTGAGGAACTATCAAGGCATTCCCAAAATGTTAAAT
AGGCAGTGGACAATTTGGAACTAGAGCACTGGGTATTGATTAGACTGGAGATGAATATGG
CATTACTGTAAAGTCTTAGTGTTTTCCTGGGAAGAGCAAGAAATTAGAAATTTAGAAAGA
TGGATGCCACTAGGAAGATACTGGTAATATCTTCTAGTTTGGCTGTTTAAACTCTAGTTC
CACTAAACAGGTTGGGATTTATAGCTACTCACACATTCTTTTTCTTGTGCATCTAGACTA
AATTCTTTGCCAGGAGATGAGCTAGAATTTGAGATTTATAAAGCATTATTGTATGTCCTC
ATACAACTCTGTTTACTTTAGATTGCACAGCCAGGAGCAGCGTATTTTTATGTTGAACTT
GACACAGGAGAGAAACTTTTCCACAGAATTAAAAAGAATTTTCCTTTGCAGTTTGGAAGG
TTTGTATGTTTTTCTTCTTTTCAATGTATTTTCACTAGACCTACTATGAATAAAGTGGTA
GGTTACGTGGACAATTGATAAAAAGCCAAATAATAATGGGTCCAAGGCACCCATGACCTT
AAAGTTAAACCTGAGAGACAGATTTAGAGGGCAGAGATTGGGGTGAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved