Microcebus_murinus Locus Mono:213:SNORD56
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:213:SNORD56
Microcebus_murinus
Mono:213:SNORD56
GeneScaffold_2186
SNORD56
1001..1072
2072
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTATTATTGTCAATGTCTTTGTCTCCAGAACAGG
GTTTTTCTGACAACATAAAATTCACTCCATGAAATAAAAGGATAAATTCAAATTACATAA
AACATTTCTATATTAGAAAATTTCCATAAGCAGAATCAAAACATAAATGTCAGTATGGGA
AAGAGAAAGTTGCAGTCCATGCCAAAATTTCTCTAATTTATGAAAAGCTCCTACAAATCA
GTGTATCAAGAAACTAACAATGTATCAGAAAAACTATGAAGGGTATGAACAATCAAAAGA
AAAAATAAGGCTCTTAAACCTAAGAAAAATGTCTCAATCTAACTTATAAGACAAATACAT
GTTAAAACTACATTAGCAGTTCCACTTCTGGTTGAATGTGGAAAATCACAAGAGGCCACT
GCTCTCACCCCAACAGCTTGATTAGCCACTTACACTATAAAACCATAGTATTTTTCAAAG
CCAAACAAGCTGAGGAGACATAAAAACGTAAGTGAACTAATTAAATCTTAGGAAGTGACA
AGCTCTTCAGAAAAGAAACCCATGGTTACTCTCATTCCTGGTAGAAACTCAAGTAGATAG
ATTTGCCATGGATGGGGGTAAGGAAAAACCAGCCAAACTTTAAATCATCTTTTACCAGGC
AGCACATATGGGCTATCAAGACAAGTGAATCCCAAGGACCGCTATAATGATGGCAATATT
TTTTTGTCAATAGTAGCTCACCTACTGAGTGTTGATACTTTGTATCTGAGTGAAGAAAAA
AAAAATCCTAAGGACCATAGCCACAAAGTGAGTCTACAACCACCCATTAACACTTACCAA
CCAAAAACTCTGTAGTAATTCTGGTAGCAGGGAACAGATTGCCAACACTCTACTAGCTGT
TAGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved