Microcebus_murinus Locus Poly:8:SNORD88
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:8:SNORD88
Microcebus_murinus
Poly:8:SNORD88
scaffold_7735
SNORD88, SNORD88
1001..1090, 4106..4194
5194
CTTGAAGGCCTGCCTTGGATTTCCGATCTTCCGAATATCTTTCCGAGGGGCCTGGCCTC
TTAATCTTTTATATCCTCTGCAGAGTAGTAAATGGAGTTGATCATTAGATATGGCAGGCT
TAGAGGGGATTTCTGGGGACATGGAGTAGGGACTTGTGAGAGGTGAGGAGAAAAGCACTG
GGTCAGGACAGGAAAGAGGAAAGGGACCTGTAGCATGTAAGGGTTCTAAGCCATAGAACT
GCCAAGTTGTAAATGTTCCTCCCATTGTTCATTCTGGTGGCCACTGACCACAGGAGGGTC
TTAAGCACCTTGAATGTGGCTAGTGTGTGTAGGAACTGGGTTTCTAATTTATTTTATTAG
TTTAACATTTGAGGAGCAGTTGCCTCTGTGAACAGCATGGTCCTACACAGAGTAGATTTC
TGTGTTGCTAAATAGCATCTGACACTCAGCGAGCAGTTGCTGTGTTGTAGTTCTTGGGGG
AGAATGAACTCAGCAAATCCTACCAGGGTCCCAGGGAGTGGCAGCTGACCTTCCCTGGGC
GAAAACTCTGGTGAATTCCCTTCTAGAGTTACAGGGCTAGGCAGTTTGTAAGAGCTGGGT
AGGGGGAAGGAAGCCCACCTGAGGAGTGGGCAGAAGCAGTCAAGGAGTGTGCTCATTAGG
GTGGGATGTCTGACCAGACTGGGTCTGAGCAGGGCTGGGTCAGACCCTCTCCTCTCACTG
AACTCTGCAGGTGTGCCCTCTGCTGGGCATTTCTAGTCCCATTTTTCCATAGGGAGAAAC
AATCTGAGGGCAGCTTAGGTCAGTTGATTGCAAATCATATACAAGGAGCAACACCCAGCT
TCAGCTGGACAATAAGGGGTGACCTTAGGGACCTCACATCAGAAAGTAAGCCCTGAGGAC
TTGCCTCATCACCCACAGGGGCCAGGTAGAAAGGTTGTTTTTTTTGCCAGGATCTCTGAG
TTGTCTACTGCCTTGTCCCCCTAGGACAGTAAGTGGCACTGGGGCCTCCATGATGTCCAG
CACTGGGCTCTGATCCCCACTGAGGACACTGTGCCCTCTGGGACTTTGACACTCAGGGGT
CTGAGAGGCCCCAGCTCTGGGGAGGGGATGATGGAGGTGCCATGGCTGCCCTGCACCCCA
CTGACATCCTCCCTCCATCCCCCATGTCTTGTTCCCTCCTGCCTACAGGTGGCTCCTCCA
GGCATTGGACGCCCAGCCCAGCCATCCCTCTCGGTAAGATCAAGAGGCTGCCTCTTATTA
GCGGTGGCAGTAATACTGCTCACACAAGTTAATGCTGAGCGTTTGCTCTGAGCCAGGCGC
TGTTCTAAGCACTGGAATTGTTTAACATGCTTAGTGCAACAGTAGAAAAACACAATGTTT
TCCTGGGGCCACGGTGTTTTATTATGAAAATAGAATAAAAACTTTGAAAACAAAATGATC
CTTAGTAATTTGAGGAAAAATTTGTTTTTTTATTATTTTCTGTGCATGAGTTATATGCAA
CTCACGCAGTGCTAGAATCAATTTTTACACTGTACACCACGTCATTGTTGTATGTGACTC
ATGACATAATTCGTGAATTTATTCCTGAGAATGGGTGTTTTGTCATTCCACAGGTATTTA
GTTGTGTCTGGAGTAGACCTTGGGTGGTCCTGGATGACAGCCTCTGAATCATACCCACTA
AGTATGTGCACAGTGTCACATTGCCACATGGTGTTCCACTGATTTTGTTCAAAGGGCTGC
CAGGCAAACATTCGGGGGAAATGCGCAATCGGGAGTTACGGTGATCGGAGATACAGTCCA
GCACGTGGTGGCGCACTTGGGCAGGCCCGCTGAAACNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATATGGGCACTGCCAGAAGAAGATGTACTGTGTGCTACGAGAGAACACAA
GCTGAGAAAGGGTGGGAATATGCCATGAAGAGGTGTAAACAGACAGCATGGAGATGCAGC
AAGTGCAATGCGTACTTTTGTGTAGAATGCTTTTTCCTAAAACACACATCAATAAAAAAG
TAGTATTAAAACTTGAAAAAGTTGAAAAGGCTAAAGTGTATTTTTGACTTTTCAAGCTTA
AGTGTAATACAAAGGTGAGCATAAATAGAAAATTGAAGTTTATTGACTTCATTTAATCTA
CGTTATTAGAATTGTCAATGCTAATTGCAACAATAAGAACATAAACAAATAAGATTTTTC
ACAAGCCAACTGCAGAGTGTTTGCCCAGGTGCCACCCATCACATGTTGCCTGGGTGCCAC
ATGGCTCCGAAGGTACACATGTGAGTCATGTGTTTCACAAGACCATGGGCTCAAGACCAG
TGTGAGTTATAGACAAGTCACATGGCAGTTAATGTGTTAACCTTCATATGCACCAGGGCC
AGGGTGTCATAAGACAAAGTAGGTGTTGGGGGGTTGGGTTGCAGTGAGATGTCCTATGTC
AGGGTTCCTGAAGAGGCTGTACTTTGGGACACCTGTGATGTCTAGGACTGAGCTCTGACT
GCCCATGAGGACACTTACCCCCTAGACCTTTGTCACCCAAGCGTCTGAGGGGCCCGACTC
CCACACGGTGCTGTGTGAGGGTGCGGCCATTTCCCCGTGCCCTGTGCCTCTTCTGTGTCC
TTCCCAGCAGCGTCTCTCTGGGCTCTGCAGTTTCCTGCCTGGGAGCCACCAAGGCCTTGG
CTAAGAGCGTTGGCGCCCGCCTAGGCAGGCCGGTGGGGAGCAGGGGTGCCAGTTCTGCTT
GTACTACATGTACACTGAGCTCCTGGCAGGACCCCAGCCAGCTCATGGTCACCTGGATCC
TGTAGGCCTATGACCAGGTGGCCAGGCCCTTCCCTGAACTCCAAGGAGCCAGTGCTGCTA
GCCTGACCCTGAGTGCTGTCTTCATCTACCACTGCGAGCCCATGTAGGGGGACAGCTGTG
CGTCACTGCTCACCTGCCTGCTGGTGGCCTGGTGCCAACACTGAGTCCTTCCTGATCTTC
GAGGCCACCAAGCTGCCCTTTGGCCCTGGGCTACCATAAAAGGAAGGCCGATTGCTATGC
CACTCTTGGCCCCCTCATCTCCCTTCTTGCCCAAGCTGCCTAAGGGCTTGCCCTTCACCC
AGGGACAGCAGTGGCACCTGCTGACAGCAGCGCCCTCAGAGCTACTGCGGTCACTGCTCG
GCCAAGGGTGTGGCAGTGCTGGTGGCGGTCATGGAGAGCCAGGTGGTGGCCACACTGGGC
TCATGCTGGGGCCCAACCCAACGCCCATTCACCTCACTGGCTGGCTCCTCTGCCCTGACA
TGACCAGGGAGAATGTGTGTAAACAGCCACCGAGGTCCTAGAGCTGTATATCAGGGAAGA
GGCACAGACCCCACTGCTCTGTCATTGTGACCAGGCTCGAGGGGAGGAGCCTCCAGCTCC
ATGGCTAGCCGCTGGGGTGGGAGGGAAAGGTCCAGGAGAGCTGCCTTCACTTTGAGTTGG
GGGAGTCAGGGAGACTGGGACATCGTTAGGAGGAAAAAAAGCCTTGGTCAGTGCTTTGCC
AGTGTCTCTCTCCAGCTTCCTGTGGGCCAGCCATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved