Microcebus_murinus Locus Mono:193:SNORD43
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:193:SNORD43
Microcebus_murinus
Mono:193:SNORD43
GeneScaffold_1287
SNORD43
1001..1063
2063
TCGTCTTCTTTACCACTCTACTATAAAATGCTTGGGTTGTGCAGATACGCTGCGTAGCC
ACACCCATCACTAGGTCTTATTTTTGGGGTAGAGCTTATATTGTGCAAATGCTTAGAAAT
CCTGCTTGGGCTTATTTTATAGGTAGGAATTATTTTCGGGGAAACACGGTATATACCCAT
CTTGATGAGAGACATCTTTCTCTTCCCTTGCCAATATTTTGGCGGGCAGAAGGCATTAAA
GTTCCCTTCTCCTTGCACTTCCTCTCTCAGGGTGAGCAAAAGGGGGTGACTAAGGGAGCT
GCATTTGAGGGTAGGAGGAGGTCTTCACCTTGAAGCGACCTTTGAATCTGGTGTGCGCAA
GGGACCTGGAGCAAAAAGCAGAGGGGCGAAGCAGAGGCTAGTTCCTAGTCCCTAGATCTT
CAAGGGGGAGATAGAAAAAACCCTGACCTGTGAAGTCCCTACTGAGTGCTCAATCTTCAC
ACCCCTGTGCAGGAGGTACTAGTCTTGTCTCCATTTTACAGACAAGAACGCTGAGGATCC
TGACATTGAGAAACTGGCTCCAACGCACAGGGATGCACAGGACTGGAATGCAAGTCAGTC
TGAACAACACACCAGGGAAAGGGGAGGACTTGGAGTGAAGTGGGGCGGTATTGAAGCAAT
TGGCCAACCATGAAAAAGGTTGAAGGAATTCTTTTCCAAGCAAATAATTATTTTGTTTAG
AAAGTCACACGGGGACAGTGGGAGACTAAAGTGAAGACTAGTGTTTCCATCCCCAGGGAC
TATTTGCCTATGGGTATCCAGTTGTTCCAGGTCATTTGTTGGCAAGACTAACCTTTCTCC
ACTGAATTGCCTTGACAACTTTGTCAAAACTCAGTCAACCCCACATGTGGGCCTATTTCT
GGACTCAATTCGTTCCATTGACCTATTTGTCTATGTTGATGCTAACACCATATTGTTTTG
ATTACTATAGCTTCATAATAAGTTTTAAAATTGAGAATTGCACAGGTGATGAACTTATTG
ATGGGTAGACAGAGACACTGTGCTGATTGTCAAGTTCTGACTCAGAAGAAAACAATAGGA
AAAAAATTGAGAATTGCAAGCCCTTCATTTTTCTTTTTCAAACCTGTTTTGGCTGTTCTA
GGTCCTTTTCATTTCAATACGCAGTTCAGCATCAGGTTATCAATGTCAACAAAAAAGCTT
GCTGAGATTTTGATTGTGTTGAATCTATAGATCAATTTGGGGAGAACTGAAATCTTAACA
TCAGCAGGTTCAGATCCATGAACATGGTAGACCTCTCGTTTATGTGGGTTTTCTTTAATT
TCTCTCAGCAGATTTTATAGTTTTCATGGAATAGATTCTATATGTCTTTTGTCAGATTTA
TTCCTAAGTAGTTTATATTTTTTGATGCTTGTGTAAGTGGTATTTTAAATTTCAATTTCC
ATTTGTTCATTACTAGTACATAGAAATATAATCAACTTTCAAATAATGAGCTTAGATCCT
GCAACCATGCTAAACTCATATATTAGTTCTAGTAGTTTTGTGTGTGTGTGTGTGAAATTC
TATTTCATAGAATTTTCTGCAAATAAGACTGTTTTCTGAGGGGCTGTGTTCGAGAAGGCT
GCATTCTGGGAAACTCCATCCTCAGGATGTTGCAGGGAAATAGAGGAACGACCTAACACG
TGGTGGTCAAGTCCTGCCAGTTATCCTCAGCACAGCAGATCCATAGATCTAGTTGCTTCG
CTAAAACAACTGTTAAAACGGACTGATATTCTATTAATATTGGGGGCCACCCTCAGCACA
GACCACTTGATTTTCTACTCTCACCACAGTTAGACCCCAGATGAGGGCTGAGTGAAGGCA
AAAATAAACAGCCTTGGGTTAGAAAGATGTCCCAAAATAACCTTCTACAAAGCACCACCT
TCTCTCATGCCGACCTCAATGAAACCTCCTTCTTGGTCTCTGGGCTCTGTCTTGCCCCCT
CCGTAGGAGTGGGGGGTGGCAGGCAAGTGTCATGAGATCCAGGCCCACTGCCATTCTGTC
TCCCCTGGCCTCTCACCAATGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved