Microcebus_murinus Locus Mono:7:SNORA73
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:7:SNORA73
Microcebus_murinus
Mono:7:SNORA73
scaffold_25656
SNORA73
1001..1193
2193
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTATGATTTGCTTTAGGTCTCAA
TCAGCTCAGAAATTGCCAGCTAAGACCTTAAAGTATGGTCTATAATTGTAGCTGTATTGA
TTTTCCCCCTGATATGGCAAGAGATTAAAATACATTTTTTTCCAACGTGGATACCCTGGG
AGGTCACTCTGTCCAGGTGGCGTAGGGGAGCATAGGGCTCTGCCCCGTGACGTACAGTCC
CTTTCCACAACGTTGGAGATAAAGCTGGGCTTTGTGTCTGCGCCTGCATATTCCTACGAC
TTCCCAGAGTCCTGTGGACAATGACTGGGGAGACAAACCATGCAGGAAACATGTCTAGTG
AAAAAGAAAAAAAAAAAAATAAAATACATTTTTTATAAATATTCACACATATATACATAT
ATTCGCAGCAAAGAAAGATAAGGTATTTCTTTTATGATTGTTTGTTTGTACATATTTTAC
ATGCAAGCCACATTTATTTGGACTAATTAACATGTTGAATAATCCTTTTTTCAAAATGCT
CTGAAATCAACAAGTGTATCTCCTGTGGAGGTGGATGTTTTATTCGACAGCTGGGTCATG
ATCAATGATATGTTAGAGTAAAGATCTTTGGCCCTTCTTTACCAAATCCATTTTTTTCCA
TGCCAGCTTATTTATTTACAGAGAAAAACCACATCTACATCTCCACATTCATTTATCTTC
CTGATACAAAAATGTAATGAAGAAAAAATTGTTTCTTGAAGCCAAGGAGACAGTTGTATG
TTTCCCACATTTTCATATCTCATTTAAGGATGGCAATAAAAGATGATGTGAATAATCACA
TTCTGGTTGTCAAAAAGGTAGCTAAAGTTAGGGACCATGTTTCCTTAATTTCTCTAAGAC
CGTGCCATAATTATTTTGAATTAAGTGCATTAATTTTTATAAATTTGATAAGAGACTGAG
ATTATGTGTTCTGCATTTAATACAGTAGACATATTTCAATATTAATCACTTTATAATTTG
CATCATTATTATGAGGGGATATCTACTCAAAATATATTTTAATGATATCTTTCAGTACCT
CTTTTCCTAGCAGATATTTTATTCAGTTCAAATCTCACTATTCAAATAAAGAATTTGTTA
TGTTTCCTGTGTTGCCTCATTGTGCAAGATTTATGGGTAGTCCATGGAAAGTAGGAAGTC
ACTCATTAAAACTAATGTTCCTCAGTCTCCCTTGAATTTTATCAGGTACATAATGTGTCA
CTGAGAAAGCTTTATGATTCTTGTCAATGAAAGTTTGGAAAGTTGTGCAATAAACAGGGG
AAAAGAAAGAATACTCATGAATAAAAATCAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved