Microcebus_murinus Locus Poly:5:SNORD116
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:5:SNORD116
Microcebus_murinus
Poly:5:SNORD116
scaffold_17339
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1092, 3471..3562, 6978..7070, 8996..9087, 11383..11474
12474
CCACAGTTGTCCAGGTTGTTTTGCCATTCCTCCTTTGGTTCTGCCTGGTGAAATTTTTC
AGCGGGGCAACACACACACAGCACAGTCTTTGGATTATGTTTGGAGGCCAGGCATTATTG
GGGGGCATTGCTGTCAGAGATCTGTGGTCTTCTCAGCCCCCAGGTATTTAATGGAGTTGA
CCCTCTGTGTTTATATCTCTTCTCGGGGACTCTGATGTGAGGCAAGCATCCCACAAGGAA
GCCGAAAAGTGGAGGTAGACATGATCCTCCTCTGTTCCAGAAACAGAGGCCCGGAGAGAA
ACCCGTGGTGTAAATTCTTTTGGTCCAAGAGCCTGTATGTCCATACCCTTCAGAAAGAGT
TTGACCTAGAAACTGTCCCCACTTAAAAATTTCTGAGAATTTGTTAGATTCCCTTTCGTG
AGAAAAGGGCGTATTTGTAGAGGGTGAGGAACCGGAGGCGTTGGGTGGCATGTTTGGCGG
GGCAACTGGTGGTCTCTTATTCCATATGCAGCAGATGCCACAGTAAATGAGGGCATGCAT
GTTACATGGTGGGGCAGCCGATTCCTGGTCAGCTGTTGGACCTAGGGGATGGCTGCAAAG
CCAGCGTGCCATTGGTGTATGGAGTGGACCCGCTGTGAGGAAGCGGAGCAGAGCCACAGG
CCCAGGCGCTCTGGGGTTTGTATCCACGCAAAAGGGGAGGCAAACTAAGCTTAGCTGCAG
GGTCTGGGTCTGGAACGTGCATCACATTGGCCTTTCACCCTGTGTCCCTATCTGCCGTTC
TGAAGCACACCGGTGTTTCTTGTGAACTTCCCTAGATTGTGTTGCGATGGAAGGAATGGC
AGCGGTCTCTAGGGAAGAGCTCAGCACAGTGGCATCCCTGGAAATGTGAAGAGCTCCCAT
ACCCGTGAGGCACGGGATCCTGTGGGTTGTGTCGGCAAGGTGAGCGTCTCTTTCCCACGG
CACCCATTTATTCCTAAAGCACAGGGGTGAAAAATGTGCCTGGATCGATGATGACTTCCA
CATATGCATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATCCTCAT
CGAACTGAGGTCCAGCACATTACTGCCACAGCAACGGTAAGAGAGGGATGGTTTCCGTGT
GTTCCTGTGGCTGACACCTCTGGTTTAGTCTGGGCTTGGGACCTGATCCTGGTCGAATCC
CTTGGCAGATTTTGGATTCCAGGCCAGGGGATTGACCTCAGTTAGCCAGGGCGAGACAGC
ACGCCTCTGGCGCCCAGGGCTTTGCGAGTATGCCTGCACACAGGAAGAGCTAGTGTTAGC
CTGCCTCTGAGTCTCAAACTTGGTGCTTGAGTCCGTGCCACCAGGGCCTTCAGCCCCCAA
GTACTTCTGGTTGGCGATAGAGCAGACGAGTCCTTCTGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGCCAAGGAAGCCTAG
ACTTTTACCAGATATACAGCCATAGGGGAGGCAATGCCATTTCCCTTCAGATCTGGCTTT
CCCGGGACCCTTCTGAACGACGATTGTGTTTCTTCTACTCTGAGCCGGTAGCACTGTCAT
GGAAGGAACGCCAATGGCCATGTCAGACCTCGTTGTCATTCTGAGATCCCCTTGAAGTCA
ACGGAGCCCATGGACACGTGTGTCGTGGAAAATGGACCACCGGACGTGAAAGTAAGCGTC
TCCGCCCCAAGACACACAGTTTCTTATGTTGCAGGGCCACAGAATGTGCCTGGATTGATG
ATGACTGCCAAATACACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCG
TCGTTCTCAACGGACTGAGGTCCAGCACGCTTCTCTGACAGGGAATAGAGAGAGAGGGTT
GACTCCCTGACACTTATCGATGTGGGTGGTACCGTGGGGAGATTAGGGAGTGGTCTTCAT
GGTGGGTGGGAGTGCCCACGGAGCATTTAGAAGTCCAAGGCCAGGGGACAGCTTGTTGGA
ATGACTGTGGCCTGCTGCGTAGGGCTTGCACACCGCCAGTTATCTTTGGCACGTGAGAGT
GTGGGTGGCACGGTTAGAAGTAGCCGGTAGCCTTCCTGGGAGCATAAAGGGTGGTCCTTG
AAGTGATGCCACTTAGTTGCCCCATCCCCCAGTGTAAGAGAGGTCCTCGTGGTCAGGAAG
AGAGCACAAGGCCACACCTCTGCCATCCTTTGGCTAGAATTTGTCAGTGGCCGAGGATCT
TGGTGTGTGCATGGTGGTTGGGTAGAATCCTTGTCAGGCAGCATTGGTAAGTGGGGTCCA
GCGTTTCTTATTGGTGGGGGGAGTCCTGAGAAGGACTTTGTGTTGAGCTCCTACATCAAG
AGTTGTCATCCAAGTTGCCAGGCCAGCGATGAGTCTCGCAGAGCGAAAAGGGGCACGGAG
TGCCACGTGTACAACCTGTGACCCCGTTGGAGGGGAGTTGGTTTTGCGAGTCTTCTTTGG
GCGTGAAATGGTGGACAAAGGGTTTCAAATGCTACACTGACCCCAGGGTGCTGGCAGTGG
GATACCATGGCGTGTTGCACGTGAGTTCAGGTGTGCACATTGTGTAGGTTTCTTGAAGGA
GTCCCCTCCCGACCCTGACTGGGATTTTTGTGTCCATGTGGCACTTGCGGCTCGCGTTGG
TCCAGATTTCCTCACAGACATAGGTGCGTATGGCACTGGCAGGAGTTCCTTGCTCCCCGT
TTTCGTTAGTGGTTAAAGGGAAGGTTTTCCTTGGACTTTCCAGATAACCGTTGCCTGCAC
ACTCCCCAGACACCTTAGCACACTTCAGGTTGGGGCGAGCCTGGGAGTCCTAAGGTCGAC
GTGACACATGTGTGGCCCCACTGAGGAAATATGTCATTTTTTCCTGTTGTCAGGTCATTT
TGCCATCTTTTCTGGTGTCCCTCTTTGGGCAACAGTGATCATGTTTTCGGTGGCGATAGT
GTCCCCTGGCCACAAGTGAATCGGGAGGCGGATTTGAGAGGCAACATGGAGGCTGTGTTT
AGAGGCAATGTCCTGAAGTTGTTCAAAACTGTGGGCCTCCGGGTGTTAGAAGCCCAGCAG
TACTGAGCCTGTCTGGCTTTCATGGTGGTACTTGAGTTGCCCCTGTGCAGCAGGCAACTG
GGTCGATGTAGATTCCTGATGTGACGTTTCTCCTATGGATAGGATTTTAAAGGGTGTCGC
CCTAAAAAGGCCTAGATGCCAGGAGAACACCACCCTTTGTGTAGGAAGTAAGAGCTTGCC
TCTGAAACCGGCCTGGTGGAAGTACGCCAGTGTTGTTTGTGTTGTCCGAGGGCCAAGGAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCA
GGGCCACAGAATGTGCCTGGATTGATGATGACTCGCCAAATACACATTCCTTGGAAAGCT
GAACAAAATGAGTGAAAACTCTATACCGTTGTCCTCATCGAACTGAGGTCCAGCACACTG
CTCTAACAGGGAATAGAGAGAGAGGGTTGACCTCCTGCCACTTTTCCATGTGGGTGGCAC
CGTGGGGTCAGTGGGAGATTAGAAAGTGGTCTTTATCACGGGAAGGAGTGCCCATGGAGC
ACTTGGAAGTCCCAAGGCCAGGGGATAGCTTGTTGCAATGACTGTGGCCTGTCGGGTTAT
CCTTGCACACTGCCAGTTGTCTATGGAACGTGAGTGTGCGGCTAGCACTGTGAAAGATAA
CCGGTAGCCTGCCTGCTAGGGGTAAAGGGTGGTCCTTGAGGTGATTCCATTTAGTCACCC
CATCCCCCAGTGGAAGAGAGGTCCTCATGGTCAGGAAGAGAGTACAAGGCCACACCTCTG
CCATCCTTTGGCTGGAATTTGTCAGTTGCCGAGAATCTTGGCGTGTGCATGGTGGTTGGG
CAGAATCCTTGGCAGGCTGCATTGGGGAAGGTGGGTCCAGCAGTTTTTATTGGTTCGGGG
AGTCCTGAGAATGTCTTGGTTTTGAGCTCCTACATACAGAGTGGTCATCCAGGGTGCAGG
GCCGGCGATGACTGGTGCCGATGAAAATGGGCGGAGTGCCACGAGTACAATATGTGACCC
CATTCTTGGGGAGTGTGTTTTGTGAGTCTTCTTTGCACGTGGAATGGTGGTCAAAGGGTT
TCAAATACTACACTGACCCCAGGGTGCTGGCAGTGGGATGTCATGGCGTGTGACACGTGA
GGTCAGGTGTGCACATTGTGTATGTCTCTTCAAGGAGTCCCCTCTGGACCCACACTGGGA
TTTTTGTGTCCATGTGGCACTTGGGGCTCATGTTGGTCTGAATTTCCTTTCAGCCATAGG
CGCGTATGGTACAGGCAGGAGTTCCTTGCCACCCTTTTTCACTGGTGGTTATGGGAAGGT
TTTCCTTGGACTTTCCGGATGACCGTTGCCTGCACACTTCCCAGACACCTCAGTGCACTT
GGGGTTGGGGAGAGCATGGCAGTCCTGAGGTCGATGTGACACATGTGTGGCCCCACTGAG
GAAATATGTCATTTTTTCCTATTGTCAGGTCATTTTCCCATCTTTGCCGGTATTCCTCTT
TGGGCAACAATGATCGTGTTGTCGGGTGGTCATAGTGTCCACAGGCCACAAGTGAATCCT
CCTTGAGTTGGAGGCCATGTTGAGAGGCAACATCCTGAAGGTGTTCGAAGCTGTGGGCCT
CCGGGCATTAGAAGCCCAGCAGTACTGAGCCTGTCTGGCTGTTGTGCGGGTACTTGATTT
TCCCAGTGAGGTAGGGACCAGGGTCTATGTTGATTCATAATGTGGCGTTTCTCCTATGGA
TAGGATTTTAAAGGGTGGCCCTTTAAAATTGATTTCGAGGCCGGGAGAACACTGCCCTTT
GTGCAGGAAGTAAGAGCTTGCCTCTGAAACCGGCCTGGTGGAAGTACGCCAGTGTTGTTT
GTGTTGTCCGAGGGCCAAGGATTTGTCTTTTGAGTAAGGAGAGTCAGCCCAAAGCTGGGT
GTGGAATTCGTCCTTCTGGAAAACCTTGGAGATGGGAACAGAGGAACATCCTTTGTATGT
GACTGAGAGCCACAGTCCCAGGCGCTCCGGGTTGTGGGTCCACGCAAAGGGGAGGCACAC
TAAGCTTAGCTGTAGGGTCTGGGTCCGGAACGTGCATCACATTGGCCTTTCACCCTGTGT
CCCTATCTGCCGTTCTGAAGCGCACCCGTGTTTCTTCTGAACTTCCCTAGATGGTGTTGC
GATGGAAGGAACGACAGCGTTCTCTAGGGAAGAGCTCAGCACAGTGGCGTCCCTGGAAAT
GTGAAGAGCTCCCATACCCGTGAGGCACGGGATCCTGTAGGTGCTGTCAGCAAGGTGAGC
GTCTCTTTCCCACGGCACCCATTTATTCCTAAAGCACAGGGGTGAAAAATGTGCCTGGAT
CGATGATGACTTCCACAAATGCATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTA
TACCGTCATCCTCATCGAACTGAGGTCCAGCACATTACTGCCACAGCAACGGTAAGAGAG
GGATGGCTTCCGTGTGTTCCTGTGGCTGACACCTCTGGTTTAGTCTGGGCTTGGGACCTG
GTCCTGGTCGAATCCCTGGGCAGTTTTTGGATTCCAGGCCAGGGGATTGACCTCAGTTAG
CCAGGGCGAGACAGCACGCCTCTGGCGCCCAGGGCTTTGCGAGTATGCCTGCACACAGGA
AGAGCTAGTGTTAGCCTGCCTCTGAGTCCCAAACTTGGTGCTTGAGTCCGTGCCACCAGG
GCCTTCAGCCCCCAAGTACTTCTGGTTGGCGATAGAGCAGACGAGTCCTTCTGGTTGTTG
ATACAACAGAAGGCCATGCCTTGGCCATCCTTGGGTCATTTTTCTCTTTGCCTGTGGTGA
TGTAGTCCCTGTGGTGACTGGGCAGACTCAGGGCCCGGCAGTCACCAGCTGGGAGACCAC
GTGGGTTTTCTTTCGCTGAGGTGCTTGTTGTGAGTGTGTACGTGTTGCTCGTGTATGTTC
GCGGATATTCAGAGTTCCATTCCTGGGTATGTCTCCCACAAAACGAAAGGGAGGAGAGCT
GCAGATGTGTTGACATGTCACCCCTCCGTGGGAATTCTTGAGTGACTTTTGTGAATATCT
TCCAGGGATTGTTTGGCTTTGGCAGCATGTTCCATGGTGGCCTCCGGTGGCTGAGGTGGC
AAAGGGACGCTGTGTCCACATGCCTGGGCATTTGAGCAGATGGCTGTTGTTTCCTGGCAG
GCTGTGATCCAGGCATGGAGTGGGATGGCTGATTCCAGGGGTTATTTGAGCAGATTATTG
GCATACAAACACCCTAAAGTGAGGGTTGTGTGTTTCGCAGGCCGAGGCCCATGGTCACTG
ATCCTGTTTGTCATTGACGGGAGTCGGTTCATTTCAACGCCTGATGCCCCCAGCCTCGCT
GTCCTGCCTCTTTAACTTTGGAAGCTCTTGGGGTGTTTGGGTACATGGCATTACAAAACT
CTCGTGTGTGACATCTGTGTTGAACCCTGGCCTGAGAAGGTTTGTGTGTTTAACTACTCC
CTTGTTCACAGTTGTCCTTGTTGTTTTGCCGTTCCTCCTTTGGTTCTGCCTGGTGAAATT
TTGCAGCGGGGCAACACACACATGGCACAGTCTTTGGATTATGTTTGGATGGCCAGGCAT
GATTCAGGTCATGGCCGGCAGAGATCTGTGGTCTTCTCGGCCCCCAGGCATTAGACGGAG
TTAACCCTCTGTGTTTATGTCTCTTCTTAGTGACCCCGAGGTGAAGCAAGCATCCCACAG
GGAAGCTGACAGGGGAAGGTAGACGTGATCCTTCTCTGTTCCGGAAGCAGAGGCAAGGAG
GGAAACCTGTGGTGTAAATTCTTTGTGAGGCAAGAGCCCGAATGTCCCTGCTCTGCCGGA
AGAGTTTGACCCAGAAACTGTCCCCACTGAAACGTTTCTGAGAATTTGTTTGATTCCCTT
TCATGAGAGAAGGGCATTCTTGTAGGGGGTGAGGAACAGGAGGCTTGAGTAGCGTGTTTG
GGCATGGCTTCTGGGTGGTGGTGGCCTCTTGTTCCATATGCAGTCAGTGCCACAGTAGAT
GAGGGCATGTGGGTTATTTGGTGGGGCAGCCAATTCCAGGGCAGCTGCTGGTCCTAAAGG
ACAGCCCCAAGGCCAGCCTGTGCCATGGTGTATGGAGTGCACCCACCGTGAGGAAGCAGT
GAAGGGAAAGGTTTTGTTGATTCCAGGCCCTAGCCGCGTCTGTTCATCCAGGAGTGTCTG
TCTTCTCCCAAAGCCAGTGGAGATCAGAGGCTTCCTGGTCAGGGGCACAGTGAGCCAGGG
ATTTTTTGAACGGCCTTGCAGGCACCAAAGCAAGAGAGTCGAGAGCATTCCTCAAAGCAT
CAGTGTTCTTTGGCATGCCGATTCACCTCGGGGGATATGGGCCTCATACGTGTATGACCA
TCATGATTCTGTTTATGTGACTGTGAAGCGGTGAAGCCAAGGAAGCCTAGACTTATACCA
GATACATGTGCGTAGGGAAGGCAATGCCATTTCCCTTTAGATCTGGCTAGCCGGGCCCTT
TCTGAAGGACACCTGTGTTTCTTCTACTCCGGGCAGGTGACGCTGTCATGGAAGGAACCC
CAATGGCTTGGTGGGACATCGTTGCTGTTTTGAGATCCCCGGGAAGACCACGGAGCCCTT
GGACACGTGTATCGTGGGAAAATGGACCACCGGACGTGAAAGTAAGCATCTCTGCCCCCA
AACACACTGAGTTTCCTATGTTGCAGGGCCACAGAATGTGCCTGGATTGATGATGACTGC
CAAATACACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATCCTC
ATCGAACTGAGGTCCAGCACGCTGCTCTTACAATGAATAGAGGTCTAGGGTCGACCTGGT
GCCATTTATCTATGTTGGTGGCACCGTAGGGTTGTTTGACTTTAGACAGTGGTTTTGATT
GTTGGTGGGAGTGTCTATGCACCAGCTGAAAGTCCAAAGATTAGGGAATGGCTTGTTTGA
ATGACTATGGCTTTTTGGAGTGGGCTTGCACACACCCAAGAGACATTACCATGTATTTCC
ATTGCTAAACATTTCACATGGATTGTTTTTGCTGCTCTACCAGGTCCTCAAGGGGTTTCC
ATCCTCTTTGAAGTGATGAGGAATGATATTGCAGTGGCTATGCCATGGAGACTTTGAATC
AGTTGTGTTAGTATAATTCGTTTTTATGCTCTGCTCGTGAGCGATTTGAGCATAATACTT
ACGGTCTTCCACGAGGCCAAACTGATTTGGAATGTGTAATCCTATAAGTGCTTCATAGGA
GATGTTTCATTCGGCAAATTGTGTTTCCCCTTGTACTCTGCAGATTGGGCTGTATATGAT
CACAGGGGGCGATCACCTCGCGGAGTGAGGAAGTGCTGGTCTGTCCACGTCCAGTGGCTG
GTTTATGTCGGCGGGACCAACAGAAGTCACTCCTGAGGTAATATCCAGTTTTGAGTGGAT
TGAGTTTTGTGGGCCATGTGAATTCCGCTTGAACATAATGAGGGACTTCCTCAGTCTGGA
GGATGGGTTGGTCACTACGGGGAGGTGTAGGCATTGGTGCACTGGTCAGGCACCTAACGT
TGTCAAGACTCGTAAAGATTTTGTGCCGACCTCCACGTAGAGCGTCTTCAGACTCCCTGT
CTGAGCGATGACGGGAGCATGATTTGCATGTGATGTCACTGTGCGATCTCCTCCCTCCTG
CAAGTTTGATAAATAGACAGCCATAATTTCCCTTATCCCATGTGTGTCCCTTCTCGCTCC
AGGATGACGTGGTCAGCATTTGGATTTCACGTGGGCAAATTCACTCTTGTCCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved