Microcebus_murinus Locus Mono:262:SNORA25
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:262:SNORA25
Microcebus_murinus
Mono:262:SNORA25
GeneScaffold_2200
SNORA25
1001..1128
2128
TCTTTTATCTTTTTGTTTTATAATAAGTCAAATTTACAAAAAAGTTGCACATTTGTATA
ATGAACTCCCAAATACTCTCTACCTAGATTGACCAATTATTAACATTTTGGCACATTTTC
TTGGTCTTTCTCCCCCCAGATCCAATCCATATGATTGTGTGTGTGTGTGTGTGTATAATT
ATTATTAATGCTATTTTTGCTGAACCCTTTCAGATTAAGTTGCAGGAATTATAATCCTTG
TCCATAAATACATCAGCAAATATCTTCTGAGAACCAGGTATTCTCTTATATAATCACAGT
GCTAAGTTATAAAATTCAGAAAATTTAATATTGACATAATACTTCTAGCTAATATACAGT
CCATATTCAATAAGTAAATATTTCTAATGGTGGGGTTTAGGCAATGTGGTAAAGAATTCT
AAGTAGTATGACAAAGAGTTTGGGGAACAGAAGAGAACCTAGTTACTACCTCTTAGAATT
CTAGATAATTCATATCTAAAATCTGTCTTGTGGCTGGGTAATAGTGGCTCATGCCTGTAA
TCCTAGTACTCTGGGAGGCCGAGGCAGGCGGATCGTTTGAGCTCAGTAGTTTGAGACCAG
CCTGAGCAAGAGTGAGACCCCGTCTCTACTAAAAAAAAAAATAGAAAGAAATTAGCTGGG
CAACTAAAAGTATATATATAAAAAATTTGCCGGGTATAGTGGCACATGCCTGTAGTCCCA
GCAACTCGAGAGGTTGAGGCAAGAGGATCACTTGAGCCCAGGAGTTTGAGGTTCCTGTGA
GCTAGGCTGACACCATGGCACTCTAGCCCGGGCAACAGAGTGAGACTCTGTCTAAAATAA
AATAAAATAATAAAATATATCTTGCTACAAAGTACAGAGAAGTGGAGGTCAGTATTCACC
AGAATAGTAGGAGAAAATTCTAAGGAAAAGTTGTGATTAAGTTGGGGATAATGAAAGATG
AGTGGGAATGGACATAAATTCTAATCTAAATTTTGAAAAACTGATCATTTCTAAGAAGGC
TCATGGAGTTATGAAACCAAAAGCTCTTAACGCTGTGGCCAAATATTGAAGTTCTCTATA
GAATGATATAACACTAAATAGTGCAATGTTTTCCTGGAGAGGTACGAGACTTAGTCATAA
AAAAAAAGAAAAATTGGGGAAAAAATCTTAAAAATGAATATTTTTATGGTGATGGTTGCA
TAATGACATAAACTAAAACTAAGCAAACTGTATACTTAAAATGGGCAAATTTTACAGGAT
GTAAATTGTACCACAATAAAGCTGTTTTTTTTTAAAAAAAGGAAAGAAATGAATGCTTTA
TTCGGATGACCAAGGAATGATGTCAGATCACAGGTGTACACATATTTTCCACTATCTGTA
AGCATCTACCTTAATATTTTCTCTGACATACCACCCCAGCTCTCCAGTATTTGTCTTAAT
ATGGATGACACAAAATTATTTTCCCACAGTTTTCTCAGATAAGTGGTTATTCTATACCGA
ATAATTTGAACAATCCCTCTACATAGAACTCAGAATATAGCTTAAGGCATAAATCCTTCA
AATGAATATGAATTATAAAACACCAATATGGGCCGGGCATCGTGGCTCACGCCTGTAATC
CTAGTACTCTGGGAGGCCGAGGAGAACGGATCACCCAAGGTCAGGAGTTCGACACCAGCC
TGAGCAAGAGTGAGACCCGTCTCTACTAAAAATAGAAAGAAATTAATTGACCAACTAAAA
CTATTTAGAAAAAATTAGCGGGGCATGGTGGCGCATGCCTGTAGTCCCAACTACTTGGGA
GGCGGAGCCAGGAGGATCCTTGAGCCCAGGAGTTTGAGGTGGCTGTGAGCTAGGCTGACG
CCAAGGCACTGTAGCCTGGGCAACAGAGTGAGACTCCGTCTCAAAATAAATAAATAAATA
AATAATACATGTTGCCACACAATCTGTACATATGCCTGTGCAACACAGCAGAATGACTTT
GTTAATACTTAGGCTTTTAAACTCACCAGTTCCAGCGACCCTCCTTCCTCTATCAGGAGA
AGGCTGGGAGGCGTCTAACCATACCAAAGAATGGAACAGCGAAGCCAGGTAGGGACCGCC
CCTCTTCCAAGTGCCTCAGGCCTTTTCCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved