Microcebus_murinus Locus Mono:52:SNORA73
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:52:SNORA73
Microcebus_murinus
Mono:52:SNORA73
scaffold_16857
SNORA73
1001..1202
2202
AATAGAGGAAATTATGTTACAACAAGCAATAATTTGAGGTCATACTGAAAAACATATGG
TTCTTTGTGAATGAAAAATTGTGAAACCTTGTAAAACCCTGCTGGTTCCATTAAAAAATA
GTCTTACATCCCCTAAACTCAATAGATGAAGAATAATCAAAAAAAGAAAAAAAAAAGATA
GTCTTACATTTAATCTAAAAAGGACCAATTCATATATGAGTTCTTTATTGTGATGTGTAG
ATTTGAATATTTGATCAGTTGCATCTAGAGTCTATCTCTTGTGTGAGAAATGTTTTTGCT
ATTTTGACTGTAGATGGATATTGGCTTAGGAAGCCTGACAAAGCCTAGAACATGTTCAAA
TTCTATCTGACTTCATATAAATCTAGACAGAAGTAGCACCTGTTGGGATGTTCTAGACTC
CATATTCCACAGATGTCTCTTACATGACTGATCAGGAGACATGGTTGAGATGCAGTTTGG
GACCATTCTGGCAGGAGGCCAAGGCTAGATTTGCAAAGGATAATCACTGGGCAGTTGTTA
GCATTACACCCCTGCATAAAAGGGTGATTTTGCCAAGTGCATTTTGTTTCATTTTAGCTG
ATTCAGATACCAAGTCGTATTGTTTTGACTTTAGGACTAGATGTTAGTTCAGGAATTTGA
AATCATACTAAATGTTTCTTTGAACATTGAAGATAAAAGGTAGCGTTAAAAGAGCTACAG
CATGGCACAGTGGCTTATGCCTGTGATTTTAACACTTTGGGAGGCTAAAGCTGGAGGACT
GCTTGAGGCCAGGAGTTTAAGACAAGCCTGAGCGAGATACTGGCTCTACAGAAAATTAGC
CGAGTATGATGGCATGTGGCTGTTGTCTCAGCTACTCAGGAGGCTGAGGCAGGAGGATCA
CTTGAGCCCAGGAGTTTGAGGTTGCAGTGAGCTATAATGATGCCACTGTCCTCCAGTCTG
GGTGACAGAACGAGACCTTGTCTCAAAAAAAAAAAAAAAATCCAACGTGGATACCCTGGG
AGGTCACTCTGCCCAGGCTCTGTCCAGGTGGCATAGGGGAGCATAGGGCTCTGCCCCGTG
ACGTACAGTCCCTTTCACAACGTGAGATAAAGCTGGGCTTTGTGTCTGCGCCTGCATATT
CCTACGACTTCCCAGAGTCCTGTGGACAATGACTGGGGAGACAAACCCATGCAGGAAACA
TGTCTAGTGAAAAAGAAAAAAAAAAAAAGCTAGAAAGTCTACATGGGGAAGCATAACACA
TTACTCAGGCATTCCATGTTTTTTGGATTGTTGGTTATGAAAACCAGGAAAATAGAGTTC
ATATAGCATGGAAGACAGGTAGAAAATACTGTAATGATCTAGTTATTCAGAGCAGCAGAG
AGCTATCAGCTCTTGCCTTTACAATCGGCTTCAATATGAAAATATATAAGCAGTAGGTTC
ACACTGCCTTTTGAATATTGAAAATAAGCCCCAATCACCTGCCTTTAGTCCAGAGAGAAA
GGCGACAAATCATTTCTTTGTTTTTGATCCAGCACATAAGTTGTCAGTTTCTTCTTTATG
TTTTATCTCATAGAGATCTAAGGTGTATAGTCACAGAATAGAACTGGATTCACAGAATAT
GCATCCTGATTTCTTTGATCTTAAGCTAGTTTTGAAGTGTGTGTGTGTGTGTGGGGGGGG
GTGTTCTCTTAGGCTTAACTTGTAATTTTGGAGCTGAGTGTAGTAGTTTGGTGTGCTCAG
CCTTCCAGTTAGATAAGTTCCTCTACCTGTGGTGCCTGTCAAAGGGGCAGGCGAGATGGC
CATGTTCTAACCAGGTGACACTGCCTCAGCCACAGCTGATGGTAGCAAGGGTGTGTGTTG
GACCTAAATCCAGCCATCTTTTACTTCTTGTTCTCTTATTCCTCATATTCAGTCAGGTAC
CATACCCTGTGGATTTTACTGTCTCAAAATCTGTATGGTCTCTTTCTCATTGCCCATGTA
CTGGTTTATGCTTTTACTGCTTCTTGTTCAGATCATTCCAGAAGCCTCCCAACTGGCCTG
AAGCTTAATTTTCTTTAAGTGTGATTTTGATATGTCACTCCCCTACTCAAAATTTGTGAC
TTCCCCACTGTCTTCTGAATTTAGCTTTGCGCATGAGACCTTTTTCTTATATATTCTCCT
ACAACTCTTCTATGTATATGCATTCCTCTTGTCATACTGGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved