Microcebus_murinus Locus Mono:150:SNORA51
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:150:SNORA51
Microcebus_murinus
Mono:150:SNORA51
scaffold_3298
SNORA51
1001..1131
2131
CCCATTGCTGGGCATCTACCCAAAAGATCCAATGACACTCTACAAAAAAGACACCTGCA
CTTGAATGTTTATAGCAGCACAATTCATAATTGCAAGGCTGTGGAAACAGCCCAAGTGCC
CATCAATCCAAGAATGGATTAATAAAATGTGGTATATGTATACCATGGAGTACTATTCAG
CTCTAAGAAACAATGGTGACATAGCACATCTTGTATTTTCCTGGTTAGAGCTGGAACCCA
TACTACTAAGTGAAGTATCCCAAGAATGGAAAAACAAGCATCACATATACTCACCAGCAA
ATTGGTATTAACTGAGCAGCACCTAAGTGGTCACATAGATACTACAGTAATAGGGTATTG
GGCAGGTGGGAGGGGGGAGGGGGGCAGGTATATACATACATAATGAGTGAGATGTGCACC
ATCTGGGGGATGGTCATGCTAGAGACTCAGACTTGTGGGGGGAGGGGGGGAACTGGGCAT
TTATTGAAACCTTAAAATCTGTACCCCCTATAATATGCTGAAATTAAAAAAAAAATAAAA
AATAAAAAAAAAAAAAGAAATGATCAAAGCCACTATGTTTTCTTAGAAGTGACCAAGGTC
ATTATCCTTTGCTCTTTTAGCAACAAAGTTAGGTCATTTACAGAGCTAAGGAAAAAAATC
AGTCCCTGTGGCCAGAGGGGGACTATGACTTTGCCACATACCCATGGGGAATAAGTAGTC
TTTGGGCTGAGACTTTGGACCCACGTTCTCCTCTGCCAAGGGCTTCAGGTGCCAACACCG
AGGCAGCCGAGGCACGAGCGCGGGTCCTGGAGGGGCACCGCGGCACAGGCTGCATGCACG
CGAAGGCTCAACTACACGGCGAGTGCGAAATAGTCTATACATCTTACGTCACCGATTCTC
AGCTTCAGAAGCAGGTGGGCCTTTCCTTTTTTGTTTATCACTGCAGCCCTAGCACCCAGA
ACAGAGGTTGGTCCATGGCATTTAGTGATCGATAAAAATCTGGCCTCCTGGAGCTTACCA
CAGACTGTGTCCTCATACCAACCGTATAGACAGAGGAGGGACAATAAACCTACCTCACAT
ACACCCAGCCCAGGCCCTGTGCCTGGTTTATATTGTGAAGGGGGGAACATGCAGAAAAGG
GGGGAAAGGAAAGAAAACAATTGTCGATCACTTAGTACTGAGGTAAGCAGGTATCACTTC
ACACGTGGGTGCATTGGTTACCACACCCTGGGTGCTATGCAGGGCTCTTTGTTGGGTTTC
CAGGATGAAATTTTTCTCTACTAAATTGCATGCATTCATTATTTCTTATGAGCATTATGA
ACTTTTGCAAATGTAGGTAGAAAGTCCATTTTAAACAGCATAGAGCCACCCTGCACCTGC
AGAGGCGTCTCAGTGCCGGCGAGGGAGAGCTGGACAGCGATCCTCAGTACCGGAGCCAGG
CAGGAAACTGCTCCCGATGTCCCCAAACGTCCTCCCCAAAGGAGAAAGGGCCTCTTGGCA
CCTAGAGCAGCCTTCCAGCTTGGTCAGCCGGGTGAGGGACACACACTGAGATGGCTGGGG
TTCCTCTGTGGAAAAGGAGGTGGCATTTTGGACAGCTCTTTGGAAAGCTGTAAAATAAAA
TGCAGTTCAGAACACATGGTGCTTGATCAAACAGGGCCTCCTCTCCAGTGCCAAGACTCA
GCAGAGGCACTCAGAGCTGCGTGTTGCATGCCAGAGTTTGCTTTCATATGCTCTGTGTGT
TGTCTCATTCTGCTTGCGGAAAGAGCCAAGTTGCCAAGATAGCAGCGTGCGTGTGTGCTG
TATGTGTGCCGTGAGTGCGTGTGCGTAGCAATGCTGACACGGTGCATTCCACAGGATATT
TATTTTTCAGAACATTAATCAATATTTTCTCTCTCATTTTAAAAAATGTTTTCCTTAGTT
CAAGTACATTTTCTGTACAGAATAATTGTCCTTTGCAATTACGAACCAAGATCAGGGGCA
CTCAATTTTTAAATTCAAAAGATTATTATTTTTCAAATGAGTCACTTTTTTTAATTTCCA
AAGAAGAGAAGTCATCATCAGTATATACTATGGCAGGAGATAAACATTGTGCTGTGCTTG
AATACATAGTGTGGTAGTTGTTAGATTTTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved