Microcebus_murinus Locus Poly:0:SNORA25
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:0:SNORA25
Microcebus_murinus
Poly:0:SNORA25
scaffold_2279
SNORA40, SNORA18, SNORA8, SNORA1, SNORA32, SNORA25
1001..1128, 2702..2833, 3695..3833, 4076..4206, 5410..5531, 5848..5975
6975
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTACAACCAACTATCTTTTTTAGGGTATC
TGAACTATATCCAACTTATTCAGCCACATGTGACCTGTCAGATGTTCAGTATTTATAATA
ACTTTATTTTCACTTTCCCAAATACCTAGAATACTTTCAACTACCATTTTATTTATTTTG
ATCACCACTGTAGACTACACATATATACTGCATTTTATGACTGCACTTGTGTTTGATTTT
GTCTAACTTGTGGACAAGGACTTACAGACAGGTGCAAAAAATAAATCCTCTTTTGCAACC
CAGAACTCATTGTTCAGTATGAGTTTTGATACATATAAGAAGGAATATTATGAAACAATT
TAAAGTGATAGGGGGTTGGCTGGACACGGCAGTTCATGCCTGTAATCCCAGCACTCTTGA
GAGGCCTAGGTGGGAGAATCACTTGAGGCCAGGAGCTGGAGACCAATCTGGGCAACATAG
CTATACACTCTGTCTCCACAGAAAATAAAAAAATTAGTGAGGTGTGCTTTCTCCTAGCTA
CTCAGTAGGCTGAGGCAGAATTGCTTTGATTAAGCCCAGGAATTCAAGGTTACAGTGAGG
TATGATTGAGCCACTGTACTCCAGCCTGGGTGACAGAGCAAGACCTTGTCTTTTAAAAAA
AAAAAAAAAAAAAGCTTAGGACATAAGAAATATTGGCTGTTTTAATTTAGTATTCTAATT
CCTGTTGACGGAAGATGGCTTTTGTTTTTTTAAGGCCTTTATCTTGAGAACATGATGTCT
GGAGTTGAAGGTATGTCTTAAAGTGAGTTTTAGAATCACATTTGTTTATGTGTGTTAGGT
AGTAAATTGTCAGATTTATTTAAACCTCTTACAGGTTACATTTTATTAAGAGACATTTGT
CGCTCCTTTAAATTCCAATTATGCGCCAGGCACGAGGATCGCTTGAGACCAGGAATTGGA
GACCAGCCTGGGAAACATAGCGAGACTGTTTCTACAAAAAATAAAATTTCAATTATGACA
TTTATGTCTGAAAAGCTATCTTAGGTTCATATATTCTATACTGCTATGGTGGCACCTTCA
GTTTCCTTTCAAGCATGAGAAGGTCCCAAATTTACAAATTAGTCTGTAATCAGACCCTTG
GATTTCCCATTTGAGGCATACAACATGTTGAATCGATGCATAATATAAAATGAGGCAGAT
TTAGATTAATGCAAGATTTAGTAGCATAATGAAATGACTACAAAAGTCGTAACATTTTAT
AAATTTGAATGACACATTTGCTTTATTCTTTATAATGCTTGTCATATAATTTACAACCAG
ATTGTTCTCCTGTTTTATACTTGATGTCAAATAACCAAGGAGATAATACTTTTATGTAGT
TTAATTCTGAGGAAAGAATTCAGTTAACATTTGCTGAAATCTGTCAATAGGGAAAAAAAC
ATCCTATATTGCAGTATTAAGTTCATATGAATCAAAGTATATTTATACTTTTTTTTTCCC
CTTTGGTTCATCTACTTGATAGTACTTTCCATACATTTTTTTTGGAAGGTGAAAAAAGGG
CTCCATACTTTTATTAGTCTACTCTGGCTTCTAAGCAGCTTGGTGAAAAAAATCCTTACC
GTGCGATTATGAAATGAGTGATTAAAGTGGTAGGAAAACCACATGTACTCACCTGCAAAT
TGGTATTAATGGATCATCGCTTAAGTGGACATATAGGAATAACATTTATCGGGTGTTGGA
GGGGGGGCATTGGGCAGTATACATAACATTTGTACCCCATAATATGCCGAAATAAAGTGG
TAGGATATTTTTCAATCTTAACTATTTTTGCAGTTTTCAACATTCAGGAGCACATGACAG
TTCTTGCTATTAATTGCTTTCCTATGGAGTCTTAGACTTATATATTTAAACAGTTAGCAG
TGGTTGAGGTCTATCCCGGTGGGGCTTTTTCTGTAGCCATACATCGTTGGAAACGCCTCA
TAGAGTAACATTGTGGTTTTGCTTTCCTCACAGGACTATTTGTTAGATCTGTGGGAAGAA
ACTACCAGACAGTTGCTAAAAGTATAAGACACCTAATAATTTGTTTTTACCGTAGGTATT
GGCATATCCCACTGATCTGTACTATTCCTGAGTGATGGCTTTAGGTGAGTTTTTTAATTG
GTGACAATGTAATTTTGGGGGAATATAGTTACAGTTCAGATGATGAATTTAACTGTTCAA
CTGCTGAATGATACAGACATGAACTAAAACTTAATTCTGACAGCTGAATGGCCATAATAC
ATATAAATCTGGATATTAAACTTAGATTTTAGTTTTTATAACTAGAAATATTTACAGCAG
CCTTTCTAAATCTTGGTACTTTGTCTGTAGGTACTAATGATTTGAACTCATTCACTTTTC
CAAGAGGTAAGTGAAATATTTAATTTGCTGAGGACTCAAAAATTATGAGAAACATGTAAA
CTGAGTATAGCATCCCAATATTTTTATAACCAGGAGTTTATTTCAGTTATAAAAGATCTT
GGCAAAATAATTTGCCACAATGTTACGTATTTTTGTATAGAATGAAAAATGACAAGACTG
ACTGGTTCATCCTTATATGTATACCTGGATATGTTGATTCAATTGAATTGCTTTAAAGGG
ATTTTTGCCCAATAAGTTGGCAATTTGAGCAACAGTGATGTTGACATTTCTAGTGCAGTC
TTACAGAGATTTGACTTGATAGGTCCATATGTAAGTTATATAATATATAGAGATTGGGCA
AAGATGACTAGAACTACAGTTTTAAATAGTTGTTTCCTGATTAGAATAATTATGAATAAA
GGTCAAATTGCTGTACCTATTAACAGGAACTTGAATTTTAGAATTTGTGTATTTTCAGTA
GCAGCATTATAAACTTGGGATAGTTAAGTCATAATTGCACTGCATGGTATCTGCATTCAG
CAGTTTACTCCTGCTGGGGTGTTCAAAGGTCAGTGCCATAGAAATTCAGTATCTGGCATC
GTTGGTTTTCTTGGCTTTGTGCATGTTAAACCTGGTATTTCTATTGATACAGTATTTCTG
TAGTTTTCTCATTGCTTAGTTTGATATAGTCTTCAATAGTAACTAATAATGCTGCTTTTT
CTAGGGTGTCAAATTGAGAACCAGGCAGATCCAACTACTCTAAAAACGTAAGGGTTTCTA
TTTCTGTTCCTTTATAGCTGCTTGCTTCTTCCCCCTATTGTTAGCATTGCCAGCATAACA
AGAACTGCATGCAGATACTTTCATGGTGTGTACAATCTGGAGATGAACTATTACAAAGCC
TCATTCTAGATGAGAATGGACACTTGATCATAGTGTCCAAAAATTGTTGATGTGGCTAAA
TTGACACAGGTTATGCTTCCATCACAGTACATGTATTACAGTGGTGACAATGAGACCTGT
AACATTTTACACAGCTTGCTGTTGAAGTGTAAGAATGTTGACTTCAGTATTAGAGACTAA
ATAATATATAGTCATGCATCGTGTAATGATGATTTTACACACGGTCAGGATCATCAGTAT
CACTGTCTTCCACCTCCACATCTGTCCCACTGGAAGGTCTTCATAGGTACTAACAGGCAT
GGGGCTGTCATCTCCGATGATGATAATACCTTGCGAAGGACCTGCCTTAGACTGTTTACA
GTTAACCTTTTTATAAGTAGAACGGGAAAGCACACTCTAAGAAGTATAATTTAGATAATG
GTGATAAGTATTGTACATAATTGTACGTGCTACATTTTTGTATGACTGGCAGTACAGGTT
TGCTTGCACCTGCATCACCAGCCTCATTATATGCAGCCCATTGTTGACCGAAACATGTGG
TGTGTGACTGCATTAGATTTATGTGTCAAAATACCAATGTACTTTCTGCAATTCAACTTT
TAGGACCGTGAAGTAACATGCTCGAAGAAATTAGGTTCCAAAAATTCTTGGTAAGTTATC
TCAAAGGCCATACAGGTATTTTGTTGAGCACTAGATCTTTTTACAAATAAGTATTCATTC
TAATAGGATTGTTAGAATCCTATTGCAACCAAAGTCTAGTAGTTGATTTATCACCATTAG
ATTTTATGATGTCAGTGTGCATTCACATTGGTTATCAAGGATGTATGATGTTATGATGAT
GGGCAAAATGTTCAACTGCTCTGAATGGGCTGAATGAAAATAGCCTTTCTGAACATCAGT
CCATGTGAGAATAGTACAATGAGCTCAGTTACCTGAAACATACATGTTTCTAAATAGTTG
TCTTTGGTGTTTGTGATCATAGAGCAGATTAACACGAATGGAAGTAGGATCATTCAGCCT
TAATTTTAAAATATATTTTAGATATTCATTTAAATGAGCTGAATTGAAAAGATACAGATA
GTTGCAATGAGCAATTTTAAGCCTGGAATTTTCAATACATAATGGTTGGGCACTGGGTTT
TAGGATACTTTGGAACCTAAACAAACTCAAGCCAGATTTCTGCATTTAATAGTAAATATG
ACTAAAATTTTTCCATAGGTGAAGAGTTTAAGTTTTCATCATTATGCCCATAAAAAAGCA
GCCAAAATAAAAAGAATTGTGGCAAGCAACTTCTGGTAAGACAAAAGCACCTTTTTGCCG
AAGAATATAATGGTCATCACCAAGGCTTTTAGAATGCAGTTTCTCATTTGCTGTGGACAT
GACCATAAAAAAACTTCCCACTTAGGTTTTCTATCTGCTACTTTGCTAGCACTCAGCCTA
GTGGGAACATTTTATTAACCCTTTATTAGACTATTTTACTTCCATTGCCTAGATGAGCAC
TGTCCATGTGAAAATACAAGGCAAGCAGCATGTGGTTATTTAATATCTGAAATTTATAGC
AAACTCATTTCACATTCTCACTGGCCACAGTGCACACACCTAGCTAATTATCATTATAAC
TCTTCTGGATTGCTAATAAGTAGGGTTTCATTATGTGATCATCTCTGGAAATGTAACTTT
TATGTTGTTATGTAGGGCTGACAGGACAACTATGGATTGAGGATCTGTTCTTTTAAAAAG
GTATGTACTACACATTAGGAAAGGGCATTGGTCATTTCAAAGAGGGCTCATGGAGTTGTG
AAACCAAGAGCTCTTAACGCTGTGACCAAATATTGAAGTTCTCTGCAGGATGTTGTAACA
CTAAATAGTGCTATGTTTTCCTGAGGAGAGGTACAAGACATTGCCACTCATCATTATGAC
ATTAAATCATCCATGATTGTTGATATGGGAAACTAAATGTCTCAGATATAACTGAAATAT
TTCTTCTTCAGGGCCATCTTGAAGGTAAATCTTCAAAGACCACCAACCTTTGAGGAACTA
AGGCTACCTTGATATGGACAGTGGAAGGGAATCATCTGTGAATTTCTTTGATAAAAATTT
ATTGACTTTAAAAAATAAATGATTTTGCCTTATGCCATAATAAAAAAACTTTTTATACTT
TTTGTAGAAAGTCAGCATGTATTTTTGGCCTCGGAGTTTCTCTAGTGGTTTTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTA
GCTTTAGAGTTATGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved