Microcebus_murinus Locus Mono:287:SNORA5
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:287:SNORA5
Microcebus_murinus
Mono:287:SNORA5
GeneScaffold_2910
SNORA5
1001..1107
2107
CTTCTATAAAGACCTCTTTGGGAAAGGAACAGTCCCACATAGGCAAAGCTGTGAAAGAA
AAATCAGCCAAAGGATAGCATAATTTAATCACAATTCCCAACACACAGCAAGGGGAAATC
TCTGACTGCCAACCTTCCTATACCCCTCCTGTAATCTGCCCCTAATACTTGCTTCAAAAG
TCCTGTCTACAATTCTACTCTCACTGTAGCTTGCAGGAAACAATGAGCATCAAGACACAA
TCTCAAGATTTAAATTCAGAGCGGGCTGCGTAACACTGAAGGGCGGAATTCAACCTGTGT
GTGTCTGGGATGCTGCTAAAAGCAGAGACAGCAACCATACAGCGAGCAACTCTCATGACT
TGTATCGGCCTTAATAGTTTTCAAAGGAATACATTCACAACACGAGGAATCAACTTCTGC
ACCCCTTTACAGAAATGACTTCACAGACAGAAAACTCTGAAATTACTACACAAGTGGGCG
GGCGGCTACCCTGAAAGAATTCTACAGATCGTGGATGTGCAACTGCCCAGACTGGAGTCG
CCCAAATTGAGAGATGCTCATTTCAAAGCCAGATCTGCCAACCTGAGCCCCGCCCCCCCA
TCCTGACCCAGGACGCTGGGTGCATCTTGCTCCTCGAACCCCTCCTCCAGGCCGGGCTCG
TCCAAATCCCCTGGCTCCGACCCTCAGCCACACGCCGCCCCTTCCCCCCCAGGCTTCAGA
AAGCCGACCCTTATTGCTGTGGCCCGACCGATGACCCCTCCTCCCCCAAGGAGACCCACG
TCTCTAGTATCCCTCACCGTGGTTTCAACTGCAGAGGTGCGCTGGACCGGAAACGGAAGT
GTGCGAGTCGGCGGGTCCCAGACTACATTTCCCGGAACCCTCCGCGCCGCGGTCTTAGGT
TCAGAGATGCTGTAAGCCAATGTCGTCTGGAGTCCTGCCCACTGCCAGGCTGCGGGCGGT
GGGTACCCGCCAGGTTCCTGCACTCGGCTATGGGGCATCGCTGCACCTTTCTTTAATAGT
CTTTACTCGGAAGGCCAGAGGAACACTGTGACTCATGGGCCCTGTTCCTGTGTCTCAGGC
TCAGGGATACATTTGGTTACTGACACCAAAAAAAAAGAGTCGAGTATACTCAGCACTGAT
ATTTGCGTTGTAGCAAATCTGACAGTATTCTCAGATATACACATTCATAATGCCATCACT
GCAGGATATGAATATAAAGTATTACTGATGGTTTAGTGTAAATTACATTTAAGTGTTTAT
TTCAAAGGAGTACATATTTGATATAAAAAAATATTAAATTCCAAAAACGAAATTAAAGTC
TCCTATAATCCTAGCACCCACAAACAAGCATAATATCTTGGCTCATTTATTTCCTGATTT
ACGTAAGTACATAAGCTTTTTTGAAAAAATCCTCTCCCCCTGAAAGGCATCATGTTTTGT
GACCTCTTTTTCCCTCAGACTACATTGTATCATGGATAGCTTTCCACCTAACTAATGAAA
TCATTTTAGATAGTTGCCTAGGATTCTTTAATTTTTACTACCTTGTCCTCCAGTGAAGTT
ATACTCCCAATCTCTTATGAAACTAAAAATCATCATTTTAATTTTTCCCAATTTGGTAGA
CTAACATGCTGCCTTATTATTGATTGAATTTCTTTGCTCATGAAAATGTTGGATAGATGG
TGATATATCAGTGGTGAGTGAATGTTTATATTCTTTGTCCACTTTCAGCTTTTATTTATC
TTTAAATTCTTTCTGTATACTAATGGTATTGACTCTGTTGCATATGATGAATTTTTTCTA
AGTTGGAACTTTTTTTTTTTTTTTTTTTTGCAAGAGTTTTACTAGTCCTGGCTAGAGTGC
TGTAGTGTCATCCTAGCTCACAGCAACCTCAAACTCCTAGGCTAAAGCAATCCTTCTGCC
TCCTGAGTAGTTGGGACCTACAGGCATGCACCACCATGCCTAGCTAATTTTTTCTTTATA
TTTTAGTTGTCCAGCTAATTTCTTTCTGTTTTTTAGTAGAGATGAGGTTTTGCTCTTGCT
CAGGCTAGTCTCAAACACTTGAGCTCAAACAATCCACCTGCCTCGGCCTCCCAGAGTGCT
AGGATTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved