Microcebus_murinus Locus Mono:218:SNORD64
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:218:SNORD64
Microcebus_murinus
Mono:218:SNORD64
GeneScaffold_4267
SNORD64
1001..1067
2067
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGTTGAAAAGA
TACAGTTCCTGGGATCAGGAATTTCATGTCTACTAGGAGACATGGATAAGGAAAAGAACT
GTGGGTTTTCTTATTTCCATGATAAAATTTGGATTGTGTGCCCATTCCACTTTGGTTCCT
TGAGCGAGGGATGTTAGAACTTAGCGTGGATCTCCTCCAGAATACTTTTGTTGGACTTGT
GCTTCGTATGTTTGGCCTGCCTTGATTTTATTTGGCCTTCCTCCTTGATTCTTCCATACT
ATTTATTTACACTTAACTCTGGAATATTTTGGTGGATATGTTCAATGTACTCTAGGTCCT
TCAGTTGGTTTAAATGTATTACTGGGGAGAATTGCAAGTTGATATTCTATCTGTCTGTGG
TGACACTGGAATATTTCCATTTTAATTCACTGGAAAATTTGTGGCAATATAAGATATTAT
ATTTAGTTCTATGAAACCCAAGATCTCAATATTATTCTTCTGGTACATTTCTGGGTGTGT
GTATGTGTGTGTGTGTATGTGTCTTTGATTTTTTTTTTCTTCATATTTTCCTCTTAATTC
TGTGTCAGTTGAATGATATTGTTGCTGTTTCACATTTATTGTCACATAAAGCTGATTCTT
CATTCTCCCAGGCCAGGGGATTGCCCATGGGTAGAGGCATGGTGTCTGCAGGTGTTAATC
CTTTTATATAGTTGTACTAGTTGCTAGGAAAGACCTTGGCTGGATTTATGGTGAGCTGTG
TTTACTGAGCATAATGAAGTGAAGCTCAAAATGATTAATCTGAAGTCCAGCTTAAAAAAA
AAATCTTACTCCTTCACTATACAGATGTGGAAATTGAGACCTCCCCTCACCAAGACTGGA
CTTTAAATCTCAAATCCTACTTTTCCTTTTTCATTGTAGAAGGTCGGAGGAGAGGAAACA
GGGGGCTGTCAGGGAGACCTCTAAATGTTTCCCAATTTTCTCAGCATCCTTCTCTCATCT
ACCTAATCCTGACTTCTTTCTCTCTCCCAGATGTATGCCTTCCTTCTCCACAGCAAAAGA
GGTTTTCAGAGCCGTACTCCCAGGCAGTAAAAAGACCTTCAAGGCCATCTATCCCAGCCC
ACCCTTTTGCTGGCAAGGGGATTGGCATTTACTAAGCACTCACTAAGTGCCATATGCTTG
TTGATATTTTGTCTTATTTATTCCCTACTTTAATCCTATGAGGTTGTGCATTATCCCCAT
TATACAGATGAAGAAACTGAGGCTCAGAGGGATTGGGCATTAGATATCTTAACTAAGACC
ACAAAGGTAATAATTAAAGATTCAATCTAGGCATGTTTGACTCCAGGACATCAGGCTCTT
TCTCTGATATTTGTTTTTTTTTTTTTTTTTTCGAGACAGAGTCTCACTCTGATTCCTGGG
CTAGCGTGCGGTGACATCAGCCTAGCTCACAGCAACCTCAAACTCCTGGACTCAAGCAAT
CCTTCTGCCTCAGCCTCCCAAGTAGCTGGGACTACAGGCATGTGCCACCATGCCTGGCTA
ATTTTGTCTATATATTTTTAGTTAGCCAATATTAGCCAATTAATTTCTTTCTATTTTCGG
TAGAGACAGGATCTTGTTCTTGCTCAGGCTGGTTTCGAACTCCTGACCTTGAGCAATCCA
CCTGCCTCAGCCTCCCAGAGTGCTAGGATTACAGGCGTGAGCCACCATGCCTGGACTCTT
TCTCTGATATTTGAATTCCTTCTACAGTATTCCTGACAAAGGATATTCCAGTCTCTTTTT
GAATACCTCCAGCGGCAGCTCACTACCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved