Microcebus_murinus Locus Mono:175:SNORA48
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:175:SNORA48
Microcebus_murinus
Mono:175:SNORA48
GeneScaffold_2693
SNORA48
1001..1117
2117
GCCCAATGAGAAGACAACACATGTGAGTTTCATATGGGAAAAAAGGGCCTTTTAGGCAA
AGGAAATAGCATGAGCAATGCAGGAGGACATTCAAGCCAAGGAAAGTTTGGGAAATGGTG
AGTAGCCGCCCTCAGAGCTGGGGAGGGAGGAGTTGGAGATAAGACTTGAGGAGTTGGGGC
CAGATTTGAGGAAAGGGGAAAGAGGGGGCTTTGAATTTTAGGTTTCACATTTAATGCCAT
TTTAATTATGTCATTTCCTCATTCTAAACTTGCACTGGCTCCTCATTGCCTGACAAATAC
AGGAAGAGCCAGTGGCTGTGCAGGATGTGTAATCTGATTATATAGGGCGAGGATGAAAAA
GAAAGATGAGCTCCACCAGCCACAAAATTGAAAGACTCCTGGCCGGCACATGAGATGGCT
ACAGCGGCACTGGGGAGGGCAAGGAGGAGGTGGCAAAACGGGTGGTAGAGCAGAACATTT
AGCCAAGTCCCCTCAAGTCCCCTCCCGGCAGCTGCTGTTGCAGGGAATCCCCACTTCCAC
GAGGCTGCTGCCCAGCCCACCCACCTGTGCTGATCCTTCCTGCAGGCCTGCCGCCTGCCT
CTGTGGGACCCTGTGGCGTGGAGTTCATCTAGCTGGAGAGGAAAACCCTCTCATGCTACC
ATTGCAGACCCCATAGGGTGAAAGGGGGACCTCATTCAGCCTTGAAACCTATGGGCTCAG
CCCCCAAGGCACCAGGAATTCCTCCTCCGTGGAGAACCAAGGCAGCTCTGGCTTTTTCTC
CCTTTGATTAGTGGTTCTAAATCTTTCTGTTATCAAGGCCCCTTTTTCTGTTGTATATAT
GTCTTGTTGCCCTTGCATTTTTATCTGCCAAACTGTGCCAATGGAGTAACCAAGCACATT
TTCCTTTCCAAATTAACAAAGACAGGACTGAGTGTGCAATAAAACCAATGTCCCAGTGGA
AAAAATAATAATAAAAACTCCTGGCCCTGTTATGGGTGGTGTGTCCCTGTCATAGGTAGA
GTGGCATCCGGTGCCCATCTCATATCAGCCAGAGACAAAGCAACCCCTTGTTTATCCCAG
CTTAGCTTTTGGTCTGTGTCCATGCCTTGGAGACATGGAGAAAACAAAGAACCAGAAAAA
AAAAAGAAAGAAAGAAGAAGAAAAGGGAGGGGGGCAACAGGCCTGATGATGAGCACCTGT
AATCCCAGAAATTTGGGAGGTGAAGGTGAGAGGATCTCTTGAGCTCAGGAGTGCAAGACC
AGCCTAGGCAACCTAGTGAGACCATGTCTGTATCAAAAAAAATAAATAAATTAGCTAGGC
CTGGTGGTGAGCACCCGTAGGTAGTCCCATCGTCCTGGAACCTGAGGCAAGAGGATGGCT
TGAGCGCAAGAGTTTGAGGCTGCAATGAACTATTATTGTGCCACTGCACTCCAACATGGG
CAACAGAGCAAGACTGTGAGAGCTTGTCTCTAAAACATAAAAATAAAAAACAAAAAGACT
CCAATAAAGTCCTATTGAATCTTTTTCCTATATTAAATAAGATATCAACCCCAAATCAAA
GCTGTTCCCAGTTAAGATACTAAAATTCGGTGATAATATTCCAATTAATTGGCTCTGTTC
CCAGGGCTCAGGGATACCAACTTGACCTTTCTTTAATGTTCCACTTTGTGAGGATAATTT
CATTCTTTCTCTCAGGAGAATTGTAAAGAAAACTAATAAAAACACTATTATATAGCACTT
AGCTGTGACTAGGGATTTAGCGTTAGTGCTCAATAAGTTCTAAATAGTTGTTAAAGCATT
TATTTCTGAGATACAGATGGTGATGTTACGCCTAGTATCACCTAGTACACTTCTTTCAGA
CTGATTTGAATTTCTGGCTATCCTGAAGAACCGGGAATTTCTATGAGTTACAAATTTGCC
TAAAGAAGATAATCAAAATTCACTTGCTATGTTGTTTAAGTTGGAACCAAAAGAAGTTCT
ATTTCTAAGGTCATTCTCTTATTTATTATTTCCATATGTTGATTCCTAAGGTATATACAA
GATTAACACAAGAACTCCAGAACTTTAAAATGGGTATATGAATACACTGTACATTTAGTG
TTAATATTAAAGTTAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved