Microcebus_murinus Locus Poly:6:SNORD115
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:6:SNORD115
Microcebus_murinus
Poly:6:SNORD115
scaffold_15448
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 2396..2476, 3793..3873, 5187..5267, 6584..6664, 7978..8058, 9375..9455
10455
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGGACGGGCCCGGCCCGGGGTCCGCAGCCTTGGGCTT
CCCCGTGTCCGTGGGGTGGGCGCATGGAGGCCTGGGCTTCTGAGGTTCCCTGCGAAGGGT
TGGGGGAAGGGACTGGCAGGCATGGGGGTGCACGTGGCTTCGTGTTGCGGACCCTGGGTC
GTGAGCGAGTGGGGTTCACGTCCAGTTGACAGGGCACGGTGGCCGGACCCGGGTCCTGGG
GTGCATCCTGGCAGAGAGGAGAAGTGGGAGGCCCTTGACCTGCCGTAAAGCGTGACCCGC
GTTGCCTGGCCCAAGCCCAGCCAGCGGTCCGCCTTGCGTGTTCTGGCCCCCAAATGCAAT
GGGTGGAGGAGGGGACCCCCAAACTCTGCAAGCATTCCACGGTCGGGATCCTCCCTCAGG
TCCCTGGAGGAAATGCATGGTAAGCCAGCCGCCGCTTCCCCAGAGGAATGTGACTGCCTT
GGGACCGACCCCGTCTTCCACATTTGCGGGCGGATACCGTCCCCGGAGAGAGAGTTCCCT
CAGAACCGGCGTGGAAGGCGCAGTGGTGCTGAAAGCGGAGCAGAGCTCGCCCTGTGCCGA
AACTCCTGTCCTTCGTGGCTCCCTCGTCTCCCGGATGGACCTTGTGGTGAGCTTCTCCCG
GTCCAAGGGCATGTGGGCATGGGGACGGGCCGCCCGGGGCTGGGTCGATGATGAGAACCT
CATATGGTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGC
CCAGCCTAGGGGAGCGTTTTGGAAGAGGACGTTGGCCTGCAGCTCTCCCGTGCGGGGCCA
TCGGTCTCTTCAGCCTGAGGCTGCAGGCCCTGGAGGCCATGCCGGGGGACCCCGAGCCAT
TGCATGCCCTGCGCAGTGAGCACCCCAAGCGCCTTGGGTGCGCTGGGTGTGAGGTGGACC
CTTCTGCAGCCTCAGGGCATGTTTGCGGCCCAGTGGCTGCGTGCTGAGCTCGTATGGCCC
CCGTCGTGTCTTTCAGGGAGCCGTGCTGCCCAGGTTGGCCCCAAGGCAGTCTCAGGATCC
CAGGTGAGTGGACCTACTGGGGCTGGAGCCAGGACCTGAGAAGCAATGGGTTGTCCAAGG
CTCCGCCTTAGTCCAAGGGCGCTTCCCTCTGGCAGGCGCATGGCGAAGTGGACCCTTCGC
TCCTCCCTACTTGAGGGGGACGATCCTTGAGGACGTCGCCCTCAGAGGGTACCCCTTTTG
TTTCCGAGCCCAGAGTTCGCTTGCAGTTAGGGAGGGACAGGGGCTCCCAGAAAGGAGTGG
CCGCGAGGACGGCTGCCACGACAGGCCCGCGTGGTCCCGGGCTCCCTATCGGGGCTGTGG
CAGGGAGCTGAGCCTCCAGCCCAAGCAAAGAGGAGGTGGACAGGCCCGGCCTCGGGTGCA
CAGCCCTTGACTTCTCATGGCCATGAGAAGCTCATGGTGGGCGCATGGAGGCCTGGGCTT
CTGAGGTCCCTGTAAAGGATTGGGGGGTGGGCCTGGCGGGCATGGGGCTGCACGCGGCTT
CCTGACCCGGGCCCTGGGTCACGAGTGAGTGGGGTTCAGGTCCAGTTGACCGGGTACGGT
GGCCGTACCCGGGTCCTTGGGTGCATCCTGGCAGGAAGGAGAAGTGGGAGGCCCTTGACC
TGCTGTAGGGCGGGAAGCGCGTCGCCTGGCCCAAGCCCAGCGGGCGGTGCGCCTCGCGTG
TTCTGGACCCCAATGCGATGGGAGGGGCAAGCGACCCCCAGACTCCGCAAGCATTCCCCG
GTCGGGATGCCCCCTCAGGTCCCTGTGGGCAATGCATGGGTAAGCCGGCCACCGATTCCC
GAGAGGAATGCGACTCCTCGGGGACCGACTGTCGTCCACATTCCAAGGCAGCTAGCGTCG
CCGGAGAGAGTTCCCTCAGAACGAGCGCGATCGGCGCAGTGGTGGTCCAAGCGGAGCGCA
GCTTGCCCTGTGCCGCAACTCGTGTGCTCCGTGGCCCCCTGTTCTCCGAGATGGCCCTGT
GGTGAGCTGCTCCGGGTCCTAGGGCGTGTGTGCATGGGGAGGGGCCGCCCTGGGCAGGGT
CGATGATGAGAACCTCATATGGTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATA
GGATTACGCTGAGGCCCAGCCTAGGGGAGCGTTTTGGAAGGGGACGTTGGCCTGCAGCTC
TCCCGTGCGGGGCCATCGGTCTCTTCAGCCGGAGACTGGAGGCCCTGCAGGCCATCCCGG
GGGACCCGAGCCGGTGCATGCCCTGCGCAGTGAGCACCCCAAGCTCCTTGTGTGCGCTGG
GCGTCAGGGGGACCATTGTCCAGCGGCAGGGCATGTTTGCAGCACCCTGGCCGCGTGCTG
AGCTCGTGCTGCCCCCGTCGTGTCTTTCAGGGAGCCGTGCTGCCCAGGCTGGCCCCAAGG
CAGTCAGGATCCCAGGTGAGTGCACGGCTGGGGTCTTGAGCCATGAGCGCCGGAGAAGCA
ATGAGTTGTCCGAGGCTGCGTGCGCTTTGGGCCAAGAGCGCTTCCCGGTGGCACGCGCAT
GGCGCAGTGGACCCGGTGCTCCTCTGTCCTTGAGGGGGACGTTCCTCGAGGACGCCGTCC
TCGGAGGATCCCCATTCTGTTTCTGAGCGCAGACTTCCCTTGCAGTTAGGGAGGGACATG
GGCTCCCAGAAAGGAGTGGCCGTGTGGACCCCTGCCACGACACGCCCACGTGGTCCTAGG
CTCCCTATCGGGGCTGTGACTGGGCGCTGATGCTTGAGCCAAGACAAAGAGGAGGCGGAC
GGGCCCGGCCCGGGGTCCGCAGCCTTGGGCTTCCCCGTGTCCGTGGGGTGGGCGCATGGA
GGCCTGGGCTTCTGAGGTTCCCTGCGAAGGGTTGGGGGAAGGGACTGGCAGGCATGGGGG
TGCACGTGGCTTCGTGTTGCGGACCCTGGGTCGTGAGCGAGTGGGGTTCACGTCCAGTTG
ACAGGGCACGGTGGCCGGACCCGGGTCCTGGGGTGCATCCTGGCAGAGAGGAGAAGTGGG
AGGCCCTTGACCTGCCGTAAAGCGTGACCCGCGTTGCCTGGCCCAAGCCCAGCCAGCGGT
CCGCCTTGCGTGTTCTGGCCCCCAAATGCAATGGGTGGAGGAGGGGACCCCCAAACTCTG
CAAGCATTCCACGGTCGGGATCCTCCCTCAGGTCCCTGGAGGAAATGCATGGTAAGCCAG
CCGCCGCTTCCCCAGAGGAATGTGACTGCCTTGGGACCGACCCCGTCTTCCACATTTGCG
GGCGGATACCGTCCCCGGAGAGAGAGTTCCCTCAGAACCGGCGTGGAAGGCGCAGTGGTG
CTGAAAGCGGAGCAGAGCTCGCCCTGTGCCGAAACTCCTGTCCTTCGTGGCTCCCTCGTC
TCCCGGATGGACCTTGTGGTGAGCTTCTCCCGGTCCAAGGGCATGTGGGCATGGGGACGG
GCCGCCCGGGGCTGGGTCGATGATGAGAACCTCATATGGTCTGAAGAGAGGTGATGACTT
AAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGGGAGCGTTTTGGAAGAGG
ACGTTGGCCTGCAGCTCTCCCGTGCGGGGCCATCGGTCTCTTCAGCCTGAGGCTGCAGGC
CCTGGAGGCCATGCCGGGGGACCCGAGCCATTGCATGCCCTGCGCAGTGAGCACCCCAAG
CGCCTTGGGTGCGCTGGGTGTGAGGTGGACCCTTCTGCAGCCTCAGGGCATGTTTGCGGC
CCAGTGGCTGCGTGCTGAGCTCGTATGGCCCCCGTCGTGTCTTTCAGGGAGCCGTGCTGC
CCAGGTTGGCCCCAAGGCAGTCTCAGGATCCCAGGTGAGTGGACCTACTGGGGCTGGAGC
CAGGACCTGAGAAGCAATGGGTTGTCCAAGGCTCCGCCTTAGTCCAAGGGCGCTTCCCTC
TGGCAGGCGCATGGCGAAGTGGACCCTTCGCTCCTCCCTACTTGAGGGGGACGATCCTTG
AGGACGTCGTCCTCAGAGGGTACCCCTTTTGTTTCCGAGCCCAGAGTTCGCTTGCAGTTA
GGGAGGGACAGGGGCTCCCAGAAAGGAGTGGCCGCGAGGACGGCTGCCACGACAGGCCCG
CGTGGTCCCGGGCTCCCTATCGGGGCTGTGGCAGGGAGCTGAGCCTCCAGCCCAAGCAAA
GAGGAGGTGGACAGGCCCGGCCTCGGGTGCACAGCCCTTGACTTCTCATGGCCATGAGAA
GCTCATGGTGGGCGCATGGAGGCCTGGGCTTCTGAGGTCCCTGTAAAGGATTGGGGGGTG
GGCCTGGCGGGCATGGGGCTGCACGCGGCTTCCTGACCCGGGCCCTGGGTCACGAGTGAG
TGGGGTTCAGGTCCAGTTGACCGGGTACGGTGGCCGTACCCGGGTCCTTGGGTGCATCCT
GGCAGGAAGGAGAAGTGGGAGGCCCTTGACCTGCTGTAGGGCGGGAAGCGCGTCGCCTGG
CCCAAGCCCAGCGGGCGGTGCGCCTCGCGTGTTCTGGACCCCAATGCGATGGGAGGGGCA
AGCGACCCCCAGACTCCGCAAGCATTCCCCGGTCGGGATGCCCCCTCAGGTCCCTGTGGG
CAATGCATGGGTAAGCCGGCCACCGATTCCCGAGAGGAATGCGACTCCTCGGGGACCGAC
TGTCGTCCACATTCCAAGGCAGCTAGCGTCGCCGGAGAGAGTTCCCTCAGAACGAGCGCG
ATCGGCGCAGTGGTGGTCCAAGCGGAGCGCAGCTTGCCCTGTGCCGCAACTCGTGTGCTC
CGTGGCCCCCTGTTCTCCGAGATGGCCCTGTGGTGAGCTGCTCCGGGTCCTAGGGCGTGT
GTGCATGGGGAGGGGCCGCCCTGGGCAGGGTCGATGATGAGAACCTCATATGGTCTGAAG
AGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGGGAG
CGTTTTGGAAGGGGACGTTGGCCTGCAGCTCTCCCGTGCGGGGCCATCGGTCTCTTCAGC
CGGAGACTGGAGGCCCTGCAGGCCATCCCGGGGGACCCGAGCCGGTGCATGCCCTGCGCA
GTGAGCACCCCAAGCTCCTTGTGTGCGCTGGGCGTCAGGGGGACCATTGTCCAGCGGCAG
GGCATGTTTGCAGCACCCTGGCCGCGTGCTGAGCTCGTGCTGCCCCCGTCGTGTCTTTCA
GGGAGCCGTGCTGCCCAGGCTGGCCCCAAGGCAGTCAGGATCCCAGGTGAGTGCACGGCT
GGGGTCTTGAGCCATGAGCGCCGGAGAAGCAATGAGTTGTCCGAGGCTGCGTGCGCTTTG
GGCCAAGAGCGCTTCCCGGTGGCACGCGCATGGCGCAGTGGACCCGGTGCTCCTCTGTCC
TTGAGGGGGACGGTCCTCGAGGACGCCGTCCTCGGAGGATCCCCATTCTGTTTCTGAGCG
CAGACTTCCCTTGCAGTTAGGGAGGGACATGGGCTCCCAGAAAGGAGTGGCCGTGTGGAC
CCCTGCCACGACACGCCCACGTGGTCCTAGGCTCCCTATCGGGGCTGTGACTGGGCGCTG
ATGCTTGAGCCAAGACAAAGAGGAGGCGGACGGGCCCGGCCCGGGGTCCGCAGCCTTGGG
CTTCCCCGTGTCCGTGGGGTGGGCGCATGGAGGCCTGGGCTTCTGAGGTTCCCTGCGAAG
GGTTGGGGGAAGGGACTGGCAGGCATGGGGGTGCACGTGGCTTCGTGTTGCGGACCCTGG
GTCGTGAGCGAGTGGGGTTCACGTCCAGTTGACAGGGCACGGTGGCCGGACCCGGGTCCT
GGGGTGCATCCTGGCAGAGAGGAGAAGTGGGAGGCCCTTGACCTGCCGTAAAGCGTGACC
CGCGTTGCCTGGCCCAAGCCCAGCCAGCGGTCCGCCTTGCGTGTTCTGGCCCCCAAATGC
AATGGGTGGAGGAGGGGACCCCCAAACTCTGCAAGCATTCCACGGTCGGGATCCTCCCTC
AGGTCCCTGGAGGAAATGCATGGTAAGCCAGCCGCCGCTTCCCCAGAGGAATGTGACTGC
CTTGGGACCGACCCCGTCTTCCACATTTGCGGGCGGATACCGTCCCCGGAGAGAGAGTTC
CCTCAGAACCGGCGTGGAAGGCGCAGTGGTGCTGAAAGCGGAGCAGAGCTCGCCCTGTGC
CGAAACTCCTGTCCTTCGTGGCTCCCTCGTCTCCCGGATGGACCTTGTGGTGAGCTTCTC
CCGGTCCAAGGGCATGTGGGCATGGGGACGGGCCGCCCGGGGCTGGGTCGATGATGAGAA
CCTCATATGGTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAATAGGATTACGCTGA
GGCCCAGCCTAGGGGAGCGTTTTGGAAGAGGACGTTGGCCTGCAGCTCTCCCGTGCGGGG
CCATCGGTCTCTTCAGCCTGAGACTGCAGGCCCTGGAGGCCATGCCGGGGGACCCGAGCC
ATTGCATGCCCTGCGCAGTGAGCACCCCAAGCGCCTTGGGTGCGCTGGGTGTGAGGTGGA
CCCTTCTGCAGCCTCAGGGCATGTTTGCGGCCCAGTGGCTGCGTGCTGAGCTCGTATGGC
CCCCGTCGTGTCTTTCAGGGAGCCGTGCTGCCCAGGTTGGCCCCAAGGCAGTCTCAGGAT
CCCAGGTGAGTGGACCTACTGGGGCTGGAGCCAGGACCTGAGAAGCAATGGGTTGTCCAA
GGCTCCGCCTTAGTCCAAGGGCGCTTCCCTCTGGCAGGCGCATGGCGAAGTGGACCCTTC
GCTCCTCCCTACTTGAGGGGGACGATCCTTGAGGACGTCGCCCTCAGAGGGTACCCCTTT
TGTTTCCGAGCCCAGGGTTCGCTTGCAGTTAGGGAGGGACAGGGGCTCCCAGAAAGGAGT
GGCCGCGAGGACGGCTGCCACGACAGGCCCGCGTGGTCCCGGGCTCCCTATCGGGGCTGT
GGCAGGGAGCTGAGCCTCCAGCCCAAGCAAAGAGGAGGTGGACAGGCCCGGCCTCGGGTG
CACAGCCCTTGACTTCTCATGGCCATGAGAAGCTCATGGTGGGCGCATGGAGGCCTGGGC
TTCTGAGGTCCCTGTAAAGGATTGGGGGGTGGGCCTGGCGGGCATGGGGCTGCACGCGGC
TTCCTGACCCGGGCCCTGGGTCACGAGTGAGTGGGGTTCAGGTCCAGTTGACCGGGTACG
GTGGCCGTACCCGGGTCCTTGGGTGCATCCTGGCAGGAAGGAGAAGTGGGAGGCCCTTGA
CCTGCTGTAGGGCGGGAAGCGCGTCGCCTGGCCCAAGCCCAGCGGGCGGTGCGCCTCGCG
TGTTCTGGACCCCAATGCGATGGGAGGGGCAAGCGACCCCCAGACTCCGCAAGCATTCCC
CGGTCGGGATGCCCCCTCAGGTCCCTGTGGGCAATGCATGGGTAAGCCGGCCACCGATTC
CCGAGAGGAATGCGACTCCTCGGGGACCGACTGTCGTCCACATTCCAAGGCAGCTAGCGT
CGCCGGAGAGAGTTCCCTCAGAACGAGCGCGATCGGCGCAGTGGTGGTCCAAGCGGAGCG
CAGCTTGCCCTGTGCCGCAACTCGTGTGCTCCGTGGCCCCCTGTTCTCCGAGATGGCCCT
GTGGTGAGCTGCTCCGGGTCCTAGGGCGTGTGTGCATGGGGAGGGGCCGCCCTGGGCAGG
GTCGATGATGAGAACCTCATATGGTCTGAAGAGAGGTGATGACTTAAAAATCATGCTCAA
TAGGATTACGCTGAGGCCCAGCCTAGGGGAGCGTTTTGGAAGGGGACGTTGGCCTGCAGC
TCTCCCGTGCGGGGCCATCGGTCTCTTCAGCCGGAGACTGGAGGCCCTGCAGGCCATCCC
GGGGGACCCGAGCCGGTGCATGCCCTGCGCAGTGAGCACCCCAAGCTCCTTGTGTGCGCT
GGGCGTCAGGGGGACCATTGTCCAGCGGCAGGGCATGTTTGCAGCACCCTGGCCGCGTGC
TGAGCTCGTGCTGCCCCCGTCGTGTCTTTCAGGGAGCCGTGCTGCCCAGGCTGGCCCCAA
GGCAGTCAGGATCCCAGGTGAGTGCACGGCTGGGGTCTTGAGCCATGAGCGCCGGAGAAG
CAATGAGTTGTCCGAGGCTGCGTGCGCTTTGGGCCAAGAGCGCTTCCCGGTGGCACGCGC
ATGGCGCAGTGGACCCGGTGCTCCTCTGTCCTTGAGGGGGACGGTCCTCGAGGACGCCGT
CCTCGGAGGATCCCCATTCTGTTTCTGAGCGCAGACTTCCCTTGCAGTTAGGGAGGGACA
TGGGCTCCCAGAAAGGAGTGGCCGTGTGGACCCCTGCCACGACACGCCCACGTGGTCCTA
GGCTCCCTATCGGGGCTGTGACTGGGCGCTGATGCTTGAGCCAAGACAAAGAGGAGGCGG
ACGGGCCCGGCCCGGGGTCCGCAGCCTTGGGCTTCCCCGTGTCCGTGGGGTGGGCGCATG
GAGGCCTGGGCTTCTGAGGTTCCCTGCGAAGGGTTGGGGGAAGGGACTGGCAGGCATGGG
GGTGCACGTGGCTTCGTGTTGCGGACCCTGGGTCGTGAGCGAGTGGGGTTCACGTCCAGT
TGACAGGGCACGGTGGCCGGACCCGGGTCCTGGGGTGCATCCTGGCAGAGAGGAGAAGTG
GGAGGCCCTTGACCTGCCGTAAAGCGTGACCCGCGTTGCCTGGCCCAAGCCCAGCCAGCG
GTCCGCCTTGCGTGTTCTGGCCCCCAAATGCAATGGGTGGAGGAGGGGACCCCCAAACTC
TGCAAGCATTCCACGGTCGGGATCCTCCCTCAGGTCCCTGGAGGAAATGCATGGTAAGCC
AGCCGCCGCTTCCCCAGAGGAATGTGACTGCCTTGGGACCGACCCCGTCTTCCACATTTG
CGGGCGGATACCGTCCCCGGAGAGAGAGTTCCCTCAGAACCGGCGTGGAAGGCGCAGTGG
TGCTGAAAGCGGAGCAGAGCTCGCCCTGTGCCGAAACTCCTGTCCTTCGTGGCTCCCTCG
TCTCCCGGATGGACCTTGTGGTGAGCTTCTCCCGGTCCAAGGGCATGTGGGCATGGGGAC
GGGCCGCCCGGGGCTGGGTCGATGATGAGAACCTCATATGGTCTGAAGAGAGGTGATGAC
TTAAAAATCATGCTCAATAGGATTACGCTGAGGCCCAGCCTAGGGGAGCGTTTTGGAAGA
GGACGTTGGCCTGCAGCTCTCCCGTGCGGGGCCATCGGTCTCTTCAGCCTGAGGCTGCAG
GCCCTGGAGGCCATGCCGGGGGACCCGAGCCATTGCATGCCCTGCGCAGTGAGCACCCCA
AGCGCCTTGGGTGCGCTGGGTGTGAGGTGGACCCTTCTGCAGCCTCAGGGCATGTTTGCG
GCCCAGTGGCTGCGTGCTGAGCTCGTATGGCCCCCGTCGTGTCTTTCAGGGAGCCGTGCT
GCCCAGGTTGGCCCCAAGGCAGTCTCAGGATCCCAGGTGAGTGGACCTACTGGGGCTGGA
GCCAGGACCTGAGAAGCAATGGGTTGTCCAAGGCTCCGCCTTAGTCCAAGGGCGCTTCCC
TCTGGCAGGCGCATGGCGAAGTGGACCCTTCGCTCCTCCCTACTTGAGGGGGACGATCCT
TGAGGACGTCGCCCTCAGAGGGTACCCCTTTTGTTTCCGAGCCCAGAGTTCGCTTGCAGT
TAGGGAGGGACAGGGGCTCCCAGAAAGGAGTGGCCGCGAGGACGGCTGCCACGACAGGCC
CGCGTGGTCCCGGGCTCCCTATCGGGGCTGTGGCAGGGAGCTGAGCCTCCAGCCCAAGCA
AAGAGGAGGTGGACAGGCCCGGCCTCGGGTGCACAGCCCTTGACTTCTCATGGCCATGAG
AAGCTCATGGTGGGCGCATGGAGGCCTGGGCTTCTGAGGTCCCTGTAAAGGATTGGGGGG
TGGGCCTGGCGGGCATGGGGCTGCACGCGGCTTCCTGACCCGGGCCCTGGGTCACGAGTG
AGTGGGGTTCAGGTCCAGTTGACCGGGTACGGTGGCCGTACCCGGGTCCTTGGGTGCATC
CTGGCAGGAAGGAGAAGTGGGAGGCCCTTGACCTGCTGTAGGGCGGGAAGCGCGTCGCCT
GGCCCAAGCCCAGCGGGCGGTGCGCCTCGCGTGTTCTGGACCCCAATGCGATGGGAGGGG
CAAGCGACCCCCAGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved