Microcebus_murinus Locus Mono:265:SNORA64
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:265:SNORA64
Microcebus_murinus
Mono:265:SNORA64
GeneScaffold_1030
SNORA64
1001..1137
2137
AACATCATACTGAATGGGGAAAAACTGAAAGCACTCTGGCTTAGAACTGGAACCAAATA
AGGTTGCCCTTTATCACTAGTTCTATTCAACATTGTGCTTAACGTTCTAGCCAGAGCAAA
CAAGACAAGAGAAGAAAATCAAGGGCATCCACATGGGGGAAGGAGAGGTCAAATTATTGA
AGTCTGAAAGACTGTGTGCATTCTAAGGCTATGTACTCTCAGGAGTAATTGAAGATGAAT
ATTTCAAACTACTAATTCTTTCCTGACCTTGAGGAAAAATTGTAAATTTCTGGAACTGTG
AAAGCAATTTCCAAGCCAGACATATATCTATGGCAAAGGGTAAAAATTTAATAGCTAAAG
GGGCTTAAGCACAACCTTTGACCAATTAGTGGTTATGCTAATGCAGGGTTGACCACTGGG
CTAAATGATAAAAACAAGGGGAAAATATTCTTAGGAGAGACAATAGAGGCTACACACTGT
AGGGCTGGGGGAAGAATAGACCCACTGATCTAATTTAGACAAATAACTAAACAAATCAAT
AAATAACCATAGTGGTGGTTGTGGTGGGAATGTAATTAGTAGGAGTTTCTACAATATGTT
ATCTAAAATGTCCAGTTGGAGATGGAAAATTATGAGACATACAAAGAAACAGGAACGTGT
GATGCATACATAGTAAAAGAAAAACAGGTAGTAGTGATTACTTTTGAGGGAACACAAATG
TTGGACTGGATATACAAAGACATGAATCAGCTATTATGTTCAAAGAAATAAAATAAACTG
TATATAAATAAAATATTATGACAATGTCTCATCAAAAAGCAAAGTTATGAGAAAATAATC
AGATGGACTTTCTGGAAGTAAAAAGTAAGATAACTTACATGAGAAATTCACTATAGAAGC
TCATCAGTATGATTGACAATCAGGAATAACTGAATTTGAACATAGAGCAATAAAGATTAT
GTAATCTGAAGAACATATAGAAAAAAGAATGAAGAAAATCAGAGTCACAAAGAAATGTAT
ACCATTAAGCACACCAATATATGTGTAATGGGATTATCAGAAGGAGAGAAGATAGATCTC
TTTGGGACATTGGATTGGCCTTATGGTGGCCTCTCTTTCTTTGAGGGGTACAAAAGTTTC
AAAAAGGGAGAGGGGAAAGAAAAAAGTAAAATTAAAAAAAATAATGTCTGAAAATTTTCC
AAACTCAATAAGAAGCATTGATCAGCACCTCTAAGAATTTCAACAAACAAAAATTTTTAT
AAACACAGACATAGTCACCCAGACATATCATAGTTGAAATACTGAAAGCCAAAGATAAAG
AGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACATAATAACAAATTTTATATA
TCCCTCAAATGAAGTTAATATATATAGAAGCAGTTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved