Microcebus_murinus Locus Mono:179:SNORA74
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:179:SNORA74
Microcebus_murinus
Mono:179:SNORA74
GeneScaffold_111
SNORA74
1001..1201
2201
ACTACAGGCATGCGCCACCATGCCCCGCTAAATTTTTCTATATATATTAGTTGGCCAAT
TAATTTCTTTCTATTTATAGTAGAGACAGGGTCTCACTCTTGCTGAGGCTGGTTTCAAAC
TCCTGACCTTGAGCAATCCGCCCGCCTGGGCCTCGCAGAGTGCTAGGATTACAGGCATGA
GCCACCATGCCTGGCCTACCATGTTTTTGTGGTAAAAAAATATTTACTATATATTATCAG
TTTTGAAATGTACAATGCATGTTACTTGTTATAGTCACTATCTATGCAATAGATCACTAA
AGCTTATTGCTTGTCTTTTTAGGATGACTTGAAAGTAAGGCATCTTTCACCTATCTGAAG
AGAGGAAATAGTGGCAGGTGGACAGTCTGCAGTTTTCAGGTAAATGTCCCTATTCATTCT
AATATTGATTATCTCCTCTGTACCAGGCCTTTTGGCCAGTTGGTATCCATCAGGAAACAG
TTGGGAGGCAAATTTATATTTACCCCCAACAAATTCAGCATCTGGGTAGTGAAAGGCTGA
GTAGAATTTTGGTGGTTTGTGTAAAGGCATGTGAAATCTTTGAGATTAGCAGTGTCATTC
CAAACCTGAGGGATTTATAGGGAGTTTGTAAATTCCATGAAGGAAAGAATAGTATACCTT
GCTTTGTTCACTGCTAGATCCCAATCACAGTACCTCGCATATGGCAGGAACTCTGAATGT
TGGATAAAACTGCTGAAAGTCTAGGTCCTTAATTAAAAGGATTTGTTCTGTAAAATTTGG
ATTAAGTCAAAAAGCCACACTCAAGGATCCTTCAGAAGGCCACATCTGGCCCCAAGCCGC
AGGTTCCCCACCCTTGAAGGGTTTAGCCAGCAGGGTCTGCAACCAGTGCTTCCATGCCTG
TTTTGCAGTCAACATTCAATTGATGGTGATACCTGTATTCGTGTCTTATACCTGGGATGC
CTAGGTATCTGAAATAAATGAGAAAACTGTTTCACGACTTATCCAGCGGTTGTCAGCTGT
CCAGGCTAGTGTGATGCCTGTGATGGTGTTACACTGTTGGAAGAGCAAGCACTGTCTTTA
TTGAGGTTTGGCTCTAAACACTGTTTTGGTGTTTTGGCTGAGTACCTTTGGGCAGTGTTT
TGCACCTCTGAGAGTGGAATGACTCCTCCTGTGGAGTTGGTCCTAGTCTGGGTGCAAACA
GTTTTGTTCTGTTAGCAAAGGACCCTGTCTTAGGGATAGCCTATCATTCTTTATCTCTTT
GAATCCTAGATGCCTTCACCTGAAAACCTGCCACCATCAGGACCTCAGATGTCTGACAAC
AGTGTGACACCAGATAGGTAATGTAGTCCTTTTGTCATGTAGGTCCTAATTAAATTGCCA
CAGTTCAGATGGGTGGAACAACTTAAAATCATGTTTTACAAAGTTATGGAGAGTATCAGA
ATTTTAGAGAGAATTCATAGAATCTAAAGTTCTAGAGCTCGCCTGTGTAATAGCTATACA
CTACATGTGGCTATAGAACAGCAGTGCACAATAAACTTTCTGCATTGGTGGAAATGTTTT
CTGTGCTGTCCAAACATAAATATCGAAATTAAGACACCGATTTTATTTAATTTTTTTTAA
CTTACATAGTCTTGTAGGCTATAGTTTGCCAGCGCCTATTCCACAGAATAAAATTCAGGC
CTTGAGAGTTGAACAGCTCATTAGTGACAGGTTCAGGGCCATACCAATATATCTCCCTGA
AAAAAATTCAGTGTTATCAATAGCTTTGCCTTAAAGGCTTATACTCTTTTTCATCCTTTA
GGTGACTGCAATAAATTAACCAGTAGTAAAATGGTCCTTGTTACTTGTGTTTGGGACTTG
TTTATGTGTACTTTTTACATGGGTTACTTTTATCATGATGGCTTTCCATTTTTAATGTGC
ACCTAAAGGGAGAGGTCCTAAGAAAGAACAGTAGTTGTCAGTTTTCAAGCTCAGTCCTAA
GTAGTAAAATAGAAATCGACCCTAAGGAGAGAGGGAAATTTTTTGTCATGACTAACAATA
GGGTTTAAAATCTGAGGTCTCAAGTTCTCTGAGCATGCAGGTTGCCTTCCTGAAGACAGT
AGGACTACCCATGTGCAGAGACAGGTCCCTGTGTCATTACTTGATAATTCATAGATGTTT
GTGTCCCTGTATTCAATATCCCAAGAGGTTTCATGGCATAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved