Microcebus_murinus Locus Mono:239:SNORA43
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:239:SNORA43
Microcebus_murinus
Mono:239:SNORA43
GeneScaffold_1014
SNORA43
1001..1139
2139
TACTAGGAGCAAAGCCATGTGGAGCTTTGGCACTCTTGGAGGGTGGTTAACAACTGAAA
CAAGAAGTAGGGAATAGTGTTTGGGTGCACAGACTCTAATATAAACACACCTACTTTCAA
TTTCCAGCTCTGTCACTGTCACTCTATGACTTTATCTCCTTTATGATAAGACTAAAGCCA
TCTAACTTATTGATGAGTTGTGAGGACTAAATGAGATTATTGAGGTACTTAGCACAGCGT
CTGGCACCTAGTTAGCCTTCAATAAACAGTAGTAATAAACCAGCAACAGTAGGGAGCTGT
TACTAACTCTAGGCCTGAAGGGACAGAGGGAAGAGAGCAGTTACTAAAACCAGCAGGAGC
TGTAGCTGTGGCCGTAGGAAAGGGTACACAACAGGAGCTATGTTATCCAGTAGAGGAAAG
AAATCAATGCCAACCTTCAGCTGAGCAGGGTGGGACCCTATAATTGTAGCCAATGCTTGG
ACCTAAGCCCAAAACAGGGACAGGGTAGAGAAGAAAGACCTACCTCTCTGTCCTTGCAGC
TCTAATATCCGGCTGGAGTCTTCCATTGGCTGGGTCCACCAAGAAGCCAGAAGACAAGGG
AGCTGGGCTGATGCAGTCTGTAGAGGTCAGCCTCCTAAGCACAATGCCTGCAAGATTTTC
CTTGCATCAACTTGTTAAAGTTGATGGGGCTTGTTAAAGAAAACCAGAGTTGGACAATAG
TTAAAGTAGTAAAATTGAATTGTATTCAGGAATTATTGGGAATAATAGGGGAAAAGAGAC
TTAAATATAGAATTGAACTCAATTTCAAATATGGCAAGGATAACTGGGAATTTATAGCCA
AGGAGCAGGTTGAGGGGTTTGGAATGCAGTGGGGGGAGGTCAGTGCATAGAAAATTACTA
AGAGGAGATATCAAGGGTAGAGGGAATTCTTGTTAAACTGACCTAATAGGATTCTTGTTG
AAGGCAGGCAAGAATGATCAGATATCGGCTGCCCTGCAGATGCTGCACTGGTCCCTGCCA
GCACCACAGGTGTGGCTGCTCTGCTGCACCTGTGACATCGGGGCAAAGAGAAAGTGGCTA
TTTCTACGCTCAGTGTTCCGAAACCAGTGAACACTAAGAATGGTTTGTAGCCTGACATTT
CCTAGAACCACAGGGAGGTAGCATTTAGCTTTTGCTTTGGAACATGACCCCCTGGTTGCT
CCACGAGGGGTGGTGGCATGTGCGGTGGTGACAGTGCCGCACTTTCAGATATCGCGGGGA
ACCCAGGCGAGATGCTGCACTTGGTTTTCATTTTCTTCATCTGTGAAGTGGGGCCAGTTA
CCAGGATTAAATGCGACTGTGTGTGTTTAAAGCCCCTGGCACATGGCAGCCTCTTGGTAC
AGTGAGACTAACCGGGAGAGGGTCTCATTCCTAGAATTCCCAGAGTGTCCTCTCCTAGAG
AGGACAGTTCTCCGGATCTGTCTGGGGAGGACTTGGGCAAGTGTGACCAAGAACCTCAGG
GGTGGTACAAACTGCCTGTGTCCTGGCCACCATTGACACTCCTTGGGTGGTCCCCAGAGG
AAGGGCCCTCGATGGTGGTTCAGGAGCTGCCTTACTCTGGTGTTGTCAGGAGCCTTGAGA
CAAGCAGGACAAGAGGAGACGTCTCTGGGTCCGTTATGGAACAGGAACACCAGAGGGTCA
CAGTAGGGTATGGAACGGGAATGCCAGAGGTGCACAGCAGCATTCTTTCTGTTGGAGACC
AAAGTCAGGGCCCTTTGGGGCCCACCAAAGGCCTGTAGATTAATGGTTTTTAACCAGAGT
GATTTGTGTGCCCTTCTCAGGGTATGTGGCAATGTCCAGAGATACCTTACATCTTCATAA
AATGGGTGGAAATGGGGGTGCTGTCTAGCAGGCAAAGGCCAAGGGTGCCGCTACACATCT
CAAAGCAATGGTCCCCAACCTTTTTGGCACCAGGGACCATTTTCATGGAAGACAGTTTTT
CCACAGACTAGGCAGGGTGGCGGGGAGATGGTTTGGGGATGATTCAAGTGCATTATGTTT
ATTGTGCACTTTATTTCCATTATATTACATTATAATATATAGTGAGGTAACTATACAACT
CACCGTAGGTTGGGGCCCTGCTACAGTGCACAAACTGACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved