Microcebus_murinus Locus Mono:211:SNORD81
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:211:SNORD81
Microcebus_murinus
Mono:211:SNORD81
GeneScaffold_975
SNORD81
1001..1074
2074
AATAACAGGTACTAGGCTTGGTGACACAAATGTAGACATAAGCAATTCTCTTGAGAAAA
CAAGACACATAAACATTTAGGAGAGTTTTAGAATGAGTTACAAATCAGAAGGTACCATGC
ATATGGTACTAAACTTTCTTCATTTGAGTGTATTTCCATACTTAGTTGGACTAAATAAGC
CTTAACTACTTTTCAACCCCCAAATGGTATGATTCTATCTTGCTCAATTCCCCAAAATCA
CTGTGAAATAAACATGGCAGGAATTGTTAATTTGCAGTTAATAGACTATGAAAATTGAAG
ATTTAATAGATTACATAACTTGCTCCAAACCACAGAGCTAGTTAATAGTGGAAGCCAGAT
AAGAAGTTAACTTTGAGTCCTAATTAATTATTCTATTAATTATATAATGCCTCTCATTTC
ATGTTTTATGATAGGGAAATCATCAGCTATCCCATTTCATAGGTTAAAATCTCATTTTGG
TGGTATGTTTTTACAAAGCAGCACATTGAATAAATGAGACTTATTCCCCAAATGATGTAA
TATTTGGGTTTGACTAGTTAATTTTTTTTTCTGCTGCTTCTCTTGCATTTCCCATGGCAC
ATTTTAGGAGCTATTTCACTGTTACCGCTACTAATCAGGACTTCGTTCACGATAACTGCT
GTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAGAGATTTTAGAA
AAGGGAATGAACTTAAATTGGTCCCTAAGTTCCTAATCCATCAAGCAGAATTTATTTAGT
TCTGGTTTATGTACAAGACCATATGGATAAATGAAATAAATATAATATATGACCCCCTCA
TCCATAAAGAACTTAAACTAAAACTTGAAAGTTTTCATAAAAATTTAAATGATGGTGTCT
ATGCTCGACATGACAAAATGTTCCATAAAATTAAAAGTCTTACAAATCCATGATGATCTC
GCCTCAGTTTGAACTCTCTCACTGATTACTTGATGACAATAAAAGATCTGATATTCTCTG
TCCAAAAAAAGAAAAGAAAAAGCTTACATTGTACATGCTCTCAAAAGATATATAAGTGCA
GTTCATTCTGAAGCCAGGTTGATCTATTAAATTACTTCTTTTCTTTAATAAAGATTTTTC
CAGATATAAAAAGTACATATGATAATTATTGTCAACTGTTGATTTCCCCCTGGAAGACCA
GTCAGAAAACTCTATTGACTAAGCAAAGCTAATGTTACTAAACTACTGCAATAAGGAAGA
GTATTACTTGATTGCATTGTAGTGTCTCGAAGGAGTAGTTTGAGCAGAATATTTACAGGG
CTTTGGGGTCAGGTCTCAAGTGATATAAGGCGTATCTTTCAAGGTAGGGAATTGATTGGG
ATTCAGCAAAGTTTATATTAGTTTAGTGAGGCAAAGGTCTTAAAGTTAGTCTTGGTAAGT
GGACTGCTGTTTACCCAGGAAAGCAATCGATTGTTCTAATAGGAGAACAATTTACCCTGA
TGAGTTAATTGGTTTGGATATATTAGCTTTCAGGAATTTTATGAAGCAACAAACTTATGC
TTTGGTTTTACCGCCTTATCTTCCTGGCCAAATATTTCCTAGAATAATGAGAGAAACTTG
GGAGCTCTAACTGGATTTAATCTCGGTGTTGCTCCTCAGGTGCCACGTGACATGGAGCAT
GCCTTGACCACCTGGTTCTCTCACATGTTAAACGTGATTTGTGATTATTGTTTATGCTTT
AAAGGATATCTGACCACATTCTAAGGGCATCCAGTGAAATTATCACACCCTTCTGTTATC
ATATGTATTTATTTAATTTTATCTAAAAGTAAACGTGTTTTTAAATTTCACATTGGGACT
TAAAATCAAAGAATAAATATTTGCATAGAGATGGAAAGACATTTATTTGGAGGGAAAAAC
TGTTATCTGGAGTTCGGAAAGTTCTTGAAAACTAAAATTATATATACTTTATTCATTAAT
AATGACATTATTATGGTATATCGCTTTCAGTAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved