Microcebus_murinus Locus Mono:272:SNORD45
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:272:SNORD45
Microcebus_murinus
Mono:272:SNORD45
GeneScaffold_1454
SNORD45
1001..1077
2077
CAAGAGTTGGAGCACCCAAGGGAAATGCATTTTTACTGGAAGCTGCTGTGGTACCTACT
CCAGATGAGAAGTTAGCATGAATGGATTTGGTGCTGGCAGGTGTTCTGATATGATTTTTA
GGAATCAAGTCTTCCAATTCCTTAGCAGGATCTTGAATAAGTGCATTGATGAGTTGAACT
GCATATCTTGTTGATTCTGTACCGCCCCTGGGGAAAAAATAATAAAAACATAAAAAAATC
CAGATAATGTTACCATCAAATAAAATTCTTAACTGTACCTTATCTAACCAAAGTATGCTT
CTTATAAATTATAATTTTTACTCAGAACTAGCAACATACATATTTCACAATTACCTTATT
GTGATCATTCTCTCTCCATTTTTATCTTTTTGCTTATCCACATCAATGTGGGCACCAGTA
ACATCTTGTATTGCAGTGATGTTGCATCCTCCTCTTCCCATTATTCTGGACACCACTGAG
GCTGGAACAGATAATTTCTTTGACCTATAAAATGAAAACTTACATATGAGCTTATGAAAT
TAAATGTCTATGAATAATAAATGTTAAAGACATATCAGTAAGTATGTTCATGAGCATCTA
TAGAATATTATTCAAATCTTAATAAAGGAAATTCTTAAAATTAAATGGGCTGGGTTTCTT
TTGTTGTTCTTATTTTTCTGATTGGTGCTGGGAGTTGTCATCACATTGGCCCTTTTTCAG
AAACTGACCTCTTTTACCACATTGAATTTAATTTAATAAAGTTAAAAATTCCATTGCCAT
TTCAAACAAAAATTATATTTAAATCACTCATAATCTAAGCATTCAAATCTGCCCAAAATA
TCACATATCAACTAAGCTGCAACGGCCATATGTGTTAACTTTTTCTAAATTATAATAATG
AATGCCATATTATTAAAATCCATATAGAATAATATATGCTAGCACATTCATTTTAAACCA
ATATCAATAGCTCATACTTAGTAATAAAAAATAAAGCCTCAGGTCAATGATGTGCTGGCA
TGTATTCTGAATCTAAAGTTGACTATTAGTACTTTAGCTCTAGAATTACTGAGACCTGAA
AAAAAAAAAAGAAAAAAGAAAACCTCATATTTAAACTATAAAAAAGCAACTCACAGGTAA
TCCAAAAAAGCCACCATTGCTTATGTTATATAAAATATGCATGCAAAATTTATAGTCGCT
TCTATTAATAATTTTGCTTTAGCATATTCTGGATTTAGTACAGCACTGCAGTTTAAAGCA
ATAACACATCCAAATTATTCATTAATTAACTAGGTAACCATTTCACAAGAGAAGGAAAAA
GGTTATGAAAGTTAAAAACAGATGAGACTAATTCTACTTACCTCCGTACAACTTCTTTCC
ACCCTTCTTCTCTTTTTTGGCCCCTTTTAGGACTAGTGAGGTTCAGCTTTATGTTTGGAG
AGCTTAATGGCAATGACACTGACTTGTAGCTTGTTGACAAGGAATTAGGATTCACTTCAC
CTTCAACTCTGAGAAGAGAAAAATATTAAGTCCAATAAAAGATAAATTTTAAGATAGAAA
CTCAAGAGAGTATTTATTCCTTTACAAAGTTATGCTGAAATATTTCAATTAAAATTTGGC
ATACCAACTAATGAACAAATCAAATAAATAGAAATAGAGCAAAGAGTCCATAGTACTTTA
GTAGTAAAATGAATTCCAAGGCCAAAAATTAGACCATAATCAATAAAAATGACATACTTA
GATAAAAATCAAGCATGCTAATATTTTCAACTTCAGACTATGAATCTTATAAAAGTTTCT
AATAATCTCACTTCCTAAGTAGCACATGATGAACATAATATGGGCAAATTTCAGTTTTGA
ATATTAAAGACAGATAACATGGTAGACTTAAATTGTTCAACACAACTTTTTCTTGGATAA
TGTACTTCAAATTCTTGTGCCAGGCATGAAGAAGGAAAGGTGAATATAAAGTTAACAAAT
CAGAAAAATTTACCGTGTTTGAGTTTTGGAAGTGGCGGTACTCATCTTTTCTTCTTGGGA
ATGGAGGAGTAGTGAGGGGTATCTCCTATCACTAGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved