Microcebus_murinus Locus Mono:8:SNORA2
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:8:SNORA2
Microcebus_murinus
Mono:8:SNORA2
scaffold_28228
SNORA2
1001..1137
2137
ACCTTCTCGTTGGCCTTCCCAGGGGCTGGCCTGGTGTCTCAGGGGTGGGGACACCGTGG
CTGGAGAGCAGGAGCTGCGCTTTCCTGTAAGCGCGTCCACCCACCCGGCTCTCGCCCAGA
CCAGCCTGCTCCCCTCACTCCCCCCTTCCACATTCTGCAAGTTCTTTGGGAAGCAGGAAG
GAAGTTCGCAGGCCTTGTCCAGAACACGGTGGAAGAGAACTTGCCACAGAAACGGTTCGA
ATGCTGCTGTCCAGGGTGTGGAAACCCTGGGGCCCTTGCACCCTCCGCAGCCTGGTGCTG
GGGCGGCCTGAGCCTGCCACTCTGCACCTCCCGCCACCCAGCCCGCAGCCAGGCCCCTCC
AGACGGCCCAGCCACTCCTCCCGACTGTCTGGGCTCACTCGGGGCAGGTGGGGAGAAAGC
AAGAAGCTCCTCATCTTGGTGATCCCTAAGACGTGGCCAGCCGGTGGCATCTCCCCATGT
TGAATGTTGCAAATAATACTGTAATGACCCTTCCAGATGAAAGGCAGCACATTAAAACGA
TTTTATTTCCTATTTCTAATTGATTACATTCTCCTCTGTTGATTGGCAAGTGAGTGGTCA
AGCGAGAGATTTGCAGTTGTATCTTCTTAGGTTCTGGATGGAAACCTCAGCCCTTCTAGA
TCTGAGAGCCCCTCTTCCTTGCTCTGGTATTTCTCTAATGCCAGGAGCCCCTCACTCTGT
CCACATTTCACGTTTCTGTTCCTGACACATACACTCCCCCTCCCCTGCTTTTCTGCCTAA
ATTCCCTAAATATTTCCTTGTTGTGTCAAAGCAACACAACTGAGTCATACTCAACTGAAT
CTTAACCCTCCCTGTAACCCACTGCCCGAGGCTGCCAGCTGGGCCACCACGGTCCTTCCC
CAGTTCCCACAGTGGCCGTCTCAGACCCTGCCAGACCCCTCGAGCCCAGCTCGCCCTTCC
CCGCACCCTCCCTCTACACGGTCAGAATTCCCTCCCCGTTTTTGGCCCTGAACTACAGCC
AGCAGTTTGCTGGAGCTGTTGGTTTCAAGCAGGAGCCTAAAGAATTCTGTTTCTATGTTC
TGTTGGCCATTTCAAAACTTTGGAAGTGTAATGGTCAATTCATTGGAAAAAAACATCTGA
GTCATTTAAAAAAAAAAAAAGGAATTTCCTGCACCTCCTTCCGTCTTGTCATCCCATTGC
CACAGTCCACCTTCAGAGGCACCGTGCTGGTTACATACGGCAATGATGGCTCGATGACAC
GTACGCGGCCCTTACAGGGTGGCAGGTGCAGCATGTGGCAGGTAAGAGCCGGTAGCCACG
GCTTAAAGCCTAGTTCCACGGCCCAGCGGCTGTGACCCGAGCCAAGTTCACCTGGGCTTC
AGCTTGCTCATCTGTAAATGGGATGGTCCTCACCACATAGGGAATTAAGCAAGCTAATTT
CTGTAAAGCACTTGGAACACTGGGTGTGAACCGCCGAACCGCCCAACCGCCACCCAGAGG
TACAGTCATCCCCTGGGCCTTGGGGAGTTGGCAGGATGAAGACACCATCACAGGAAACCG
AAGTGCAGGCAGTAAGTGCGGAGCCAAGGCAGGTCACCGAGGCTGCGCCCAGGCCGCCCC
ACCCAGGCACTGCAGAAGCTAACCCTGGGCTCGACGTCACCCAGGTTTAAGAAGCCTCCG
GGGAAAGGCCCAGGTTGAACCTGAGCAGCTCGAGAGTGGAGGGCAGGGGCCGGCCGGGGA
AGGAGCTTGCACGTGGTCTGGAAGGCGGGGCGGGGAGACCTGAGATCTGCCCACACTTGG
GACGGTCTCTCCAGCTACGGGTGGGCAGTGAGCAGAGGGGCCGGGAGAGGAATGTGTTGG
GCAGATGTTGCCATAACGCGGGTGCAATCCAGGTGTGTGTGGCTTTGAATCACTTCCTCT
TTCCTCTTCTTCCTCCGCACCCCTGGATCCCGGCCCCACCTGGCCACCTCAGCCCAGGCA
GGCGCCTCCCACTCCAAACAGAGGCAGCCAGGCCTCCAGGCTGCCTCCTGCCCCCACTCT
GCCCCCCACAGCACCCCAAAGTCAAGTGCTAGAACTCACTCCACCTCCTTCACCGACGCT
GTTTCCCCAAACGTTGCGCCACGCCCCTGCTCATGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved