Microcebus_murinus Locus Mono:177:SNORD32
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:177:SNORD32
Microcebus_murinus
Mono:177:SNORD32
GeneScaffold_2941
SNORD32
1001..1082
2082
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTAGCACTCTTGGGCTCTACCCCAGAGCCACTAAACTTAAATTTCTGTGCTATC
TTCCAGGAATATGCATTTTCCACAAACTACACTGGTGATTCTTAGGCCTACCCAGGTCTG
AGAATTACTGATCCAAGTGGAGATATCAAGGCCCAAAATAATTAAGCAGTTTAGTTCTTC
AACAGTCTTTCCTGTCTCAAAGAACTTGGGGTAGAGTAAAATGAGATTGTGTCTCTATGT
TTGAAAAAAAAAAAAAAGATGTGTCATTCAAAAGTAAGGCATGGTCAGTGATGAGCAACA
ATCACCATCTTTCGTTTGAGTCTCACGACCATGAGATCAACCCCATGCACCGCTCTGAGA
CCTACCAAAAAAAAAAAAAAAAAAAAAACAAAAGTAAGGCATGAATATGTGAAGGAAATT
AAAGGTTAGTTAAAACATGGATTTAGAAAGACTGATAAGTTTTATCTTTTCTAAATCAAA
TAACTTCTGAATAAGAATTTATAAAACATCGAGGTATATTTCACATATCATGGTTGAGTG
TTTTCTTCTATTCTTACATTTTTATACCTAGATTAGTCAAAAATTATAGATTAATATTTT
AAATGCTGAGAGAAGCCAGCAGCTTGTTCCAGCCTCTGACTCAGTTAAGCTCTTACAATA
TTTTGACTGTTTGAAGAAATTAATAATGGGATGTAAGGCGGTAGATTAACTAAAACTAAA
TATCAACATAGCTAGATTTATTTTTGGATGACTGAGCTCATCTCTTCAAAGAAAGGAAGT
AGGACTTATATCATGAGTTATTAACTTATACATCACCAAAACAGCCCCCAAACAGAGCAG
AGAGACACAATATATTTAAAGATTAGTAAGAGGCTGAAAGTTTAGATTTCACATTAGCTA
GGATTTAGAATGTATAGGCTACAATTGATTACCTAAGGCTCACAAAGACACCAGAAGTTA
AGCCCGTAACTGTCCTGTCAGTTTCAGAATCAAATTAGTTACAAGTGCCTTATTCCTTCT
CCCCCGAGTAGCTAAAGAGTAGATCTCCATGCCAACCAATATGGACAAACTGACACACAT
GAAAGTCACAGATGCTTTTATTTCTGCCATTCATGTATTCATTCAGCAAATACAGGGCAC
CTGTTTGTCTCCCTTCCTTTTTCTCACCCCAGCTCATCTCCTAAGCGAGCACTATCTGTG
GATTCACAATTGTAAAGAGGACTCAAGCATGTGCTTCCAGGTCATACAGTCCCAGGACAG
AAGGTGACAGCTCCTAAGTTTCTGATGCATCCTGAAGCCCTGGTGCTACCAGGCCAACAA
CAAAAAGCTTGGTTTGGCTTTAGATGAGCCAAACTGGCTTCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved