Microcebus_murinus Locus Mono:132:SNORA72
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:132:SNORA72
Microcebus_murinus
Mono:132:SNORA72
scaffold_1482
SNORA72
1001..1127
2127
TTTTTTAAAAGTAAATTGAATTTATAGAAATTAATGGGGATTAACTAGATTATATATCG
TTTTGAACTCTCCTGACAACTAGCGGCTTCAGTAAAGATTTGAGAACCATCATAATGTCC
CCATAGAAATTGATTATCATAAGGAATCTATGATGGTAAAAAAGAGAAAAAAATAATGAA
ATATATGAGGCTTTCTTCTCAAAATGTATATAAATTGTATTGGTGGACACCAAACATTCA
CTCCTTACAGAAAATCTAAATCTAACCTTGGAAATTAGTCTACAGGTTGTACATACATTT
CACAAAGAAATTCCATCAAATCTGTTTGAGGAGACAACCCATGAGACAAGCAAAAAATGG
TTCTGTGATAGGAAGTGACTTTTAACTAAAGGTTAAATAAAATTGTACTGATGTTATTTT
AAACTGATTGCTCAAGACAGTGATTCCTTTGGAATGGTTCTTAGTTCGATTTGCTCTCTA
CTTCTTTCTGGTTGTTTTTTTTTTATCGTCAGTATCCTTTTATTTCTCTGATGCTCCTAT
TTTCATCTCTATCTACTTCTGCCTCCCCCAATCTCTCCAAAACCTTGTCTCCTCTCTCCT
TTTTCACAAGGATCTAGAGGTGCATGAAACCACCCTATTCTTTGACCCACCTCCCACCCA
TGATTACCTTTTCTTTCATCACCATTCATTTATCCCATTTGTTTTTGTTTGTTTGTTTGT
TTGTTTTGTTTGTTTGTTTTTCTTCCTAGGGATTCATCAGGGCAGAGCACTAAGTTCCCA
CCGATAATGTATATTGGACTACAATGGCAATTATGGACTGGGTTACATGCTTCATTCATC
AATGTTTACTTTGTTTACTTTGTAACTCAAGACTAAAATTTCTTGAAGGTAATTATTATT
TCTTTCTTTTTTTTTTTTTTGAAATCATCACTTTATTCAAAGTTTTCAACTTTCCCTTAC
TAACAAATCTTTTATAAGCATTCCAAATGGATGGCAAAATGAAGTGACTGTACTCTTCTA
TTTTGTAATAATCAGGACAGGCTAAACATTCGCTATGTTAAAGCTATGCACATGTCCCCA
GACCTAGTTCTTTCCCTAGGTTTGGTTTTATAAATGCTTGTGATAAACCAGGTTAAAAAA
AAAAGAGGTAATTATTATTTCTATTACTGATCTATGTATCCAAACATTTTTTAAATTATA
TACATCTTTAAACAAGGTCCTATCCTTTGAAAATTTAGCCATGGATATATTGAAATTTAA
CTTTTCCCTCTAGTAGTATTAATTATAATGGCTCTCATATATTCATTTATTCTGTTCCTC
AGGACTAAACTTGTTTTACAAATTTACCATTATAATGTATTTTAGAAAATCGTTTCAATA
GTTAGGTAAAATGGACAACTATAACATATATAAAAGTGTGTTTATACGTAGAGAGTTAAA
ATTAGGCAGTAGTTGGAATTAAACAAGGCTAGGCAAAAAAGTTGAAAAGAAAAGCTTTAG
TTTTCATTCATTCTGAACCTTTTTCAAAATGGAGTTTAATTCAAGACCTGAAGGCACATT
TTATTAGGAAAAACTCTAGCTCTACTTCAAATCTTTGCATGGGAAGTTAGCTATTAATAC
TGACTGGAATTGTCTATAATTTGGTTGCAGAGAGTTCACTCACACCTGACAATTTTGAAT
GCTAAGAACTGTCAGGGTTGATTTTTCTTCAGGGGTGTTGCCCCAGTTCTTTGTCTCCTG
GCTTGGAAGAATCATAAGCCGGACTAGTGCAATGGAGAGATGACAGACATGAGAAACTCA
CACCGCAGCTTTTACTGCAGGTTTTTCAGCATCTAAAGTGAAAGGACTTTTCTGAGGGGA
AATGGGTCTATCTCTGCAAGTGAAGAAGACGCTGAGGTCTTGCCATACTTCTACTTTTAT
GTCTACACCTCATGATTACTGAATGGTGGGCGGCATAGTCATTATTTCTGTGGGAAAAGG
GTGCAGAGTTCTTAGAGCTAAGGGCACTCCCCCATTTTATCCTTATAGGGTAACTTCCAA
GGGTTGCCATGACAATTATAAACTTTCATGGAGCTGATAGGTGCAATTTTTATTATGCAT
AATAAAAATATTAATATGCATAATAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved