Microcebus_murinus Locus Mono:32:SNORA69
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:32:SNORA69
Microcebus_murinus
Mono:32:SNORA69
scaffold_4117
SNORA69
1001..1131
2131
CAGGTTATTTCTTGTGGAAAGGGTTCAAGGACTGAAACTTTCAGAAGAAAACTCTATGG
CATCCCCACTATATCCCTAAATACATAAACCTAAATTTAAATGTTGTTAAAAATGGCAGA
TGAGCCAAATAATCATATGCCAAGCTGGTTTGAAAGTGTGTGTGCCATGAGATTTTTCTC
AGAAAAAAATAGCCCGGGCAATTCAAAACAAGGAAACATCTCTAAACATCCTGTAATTTG
TTCTCTAGCAAGGATCATGGGAATGATAGTCGAAGCCAGAAGAAATTTGAATAAACCCAG
TCTTCACTTAAAAAAGATTCAAGGGAGAATCAAGGTCCATATGGTTAAAAATGTCAAAGC
AACAACAAAGAGTATAGATATAACTAAACTTTAAAAAAATTATATAAAAATTTGTTAAAG
GAAGTATTAAATTACTTTTAACTTCTATCCTTACAAATAACAGTACCATTGTACTCTGTG
ATCTCAGAACTAAGAATTTGGGATTAGAGTCATGGTTTTTCCACCAAGAACAAAGAGAAA
AGAGCATAAGCTTAGAACTCAAAAAGCATCCATTTAAAGCTCAGCTCTGTCACTTACTAT
CTGTGGCTTTGAGCAGATTACTTTTCTTAATTCCAGTTTCTTCTTCTGAGATTTGAGAAT
AATGCCTACCTCTCAGGGTTGTTCAGAGGATTAGATGAGATAATGTAAATACTGTGCTTG
GCACATAGAAGGTATTCAAAAACTGGGTGTAATTATTGTTAATGATTGTGCTATTTCTGG
GAATGGATTAGGTTCTACACAATGCTTTGGAGAGAGCACATAAAATGAGAACAATGCATA
TATAATGCTTGCTATGATCCATATGCTGTTCTTACTTTACTCAGTAAGATGGATATTTTT
AAGTATTGCAATCATCCTTCAAGGTAGTTTTTATTATTATCATCCCTACTTTACAGTTCA
GGAAATTGAGGCACAGAAAGGTTGAATAACTTATCCAAGGTAAATCAGGTTGCAATTATA
GTGCTTCATTTTCTGGAGCACTGCCATTATCCTGCTGAAAGAATACCTGTGTTAATCATT
TTTTATTTTGCCTTTATGAGGGTAAAATAATGACAGAATGAAACGGACAATTCTGAGGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
GGACACGATATGTTCTTAAGCACCCACTCTCATGCTTACAGCATTGAGGCCACAGGGAAT
ATTTTGTAATATAAAAATAATTCATATTATTCTTTGTTGTGTGTATATGTAGGCAATACT
TAATACACACCAAGTGTGATGTCAGTTTTTCACATTGGCACTGGATGGTTATCAAATGTA
AAAACTGAAAATAGTTTTATTTTTAGTAAAATATTTAAATAGACTCAAAATTTAAAAATA
TTTCTTTCAATAATCTTGATTTAAAATTCTGATATTTAATAATTAAAATTTGTTTTTCCT
TTTTAATGTCAAGAAACATAATTTTGAACACTTTAGAAAAATCATTTTCAAACAAAATAA
TTGTCATTTTCCAACTTTTTACATTTACTTTACTTTTTTTTTTTTTTTGAGACAGAGTCT
AACTGTGTTACCAGGGCTAGAGTGCCATGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved