Microcebus_murinus Locus Mono:293:SNORA30
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:293:SNORA30
Microcebus_murinus
Mono:293:SNORA30
GeneScaffold_1448
SNORA30
1001..1114
2114
TTATTTTTTAGAGACAGGGTCAAGTTAGGGATGGATTCTTTTTTTTTTTTTTTGAGACA
GAGTCTTGCTTTGTTGCCCAGGCTAGAGTGCCATGGCATCAGCCTAGCTCACAGCAACCT
CAAACTCCTGGGCTCAAGCAATACTGCTGCCTCAGCCTCCCGAGTAGTTGGAACTACAGG
CATGCACCACCATGCCCAGCTAATTTTTTCTATACATATATTAGTTGGTCAATTAATTTC
TTGCTATTTATAGTAGAGACAGGGTCTTGCTCTTGCTCAGGCTGGTTTCGAACTCCTAAC
CTTGAGCAATCCGTCCGCCTCGGCCTCCCAGAGTGCTAGGATTATATGCATGAGCCACCG
TGCCCGCCCAGGATTCTTATTTATTTTTTTTAGAGACAGAGTCTTGCTCTGTTACCCAGG
CTGGAGTGCAGTGGCCTGATCATAGGTCACTGCAGCCTCCAACTCTTGGGCTCAAAAGAT
CTTCCTGCCTCAGTCTCCCAAAGTGCTGGGATTACAGGCATGGGCCACCATGCCAGCCAT
TAAACTCATTTTAAAGAGCCTTCACCACATGAAATGTTTGGAAAAGCAGATCTTTCTTCA
AGAAACTTACCAGGATCAAGAAGAAATCAGTCATACCAGCATAAGACCAATTATAAAGGC
ACTTTTGACTTCTGCAACATAGAGCAGAACTGGGTAAATATCTGAGAACATTCTTTCCAT
GTCCTTCTAGTGGCAGGATGTAATGCTGGAAAATACTAGGCTTGAACAGTGAAATGAAAG
CCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNAAATATACGGCTTTCTCAATTACATTCTTCATGTT
ATTTTGGGCCTTGGGCCTATACCTGATAAGCAGGTAGACTGGAAGAATCTTTAATACATA
TAGGAAATGGTATTCCTTGGTGCTGAGAGAAAATCCTTGACTGCATCCTTGCCCTGGGAT
TGTACCAGTGGCAACTGTCACTCAATGGGACAGAGACCATTCTGTGACTTCTTGCTCAAC
TTTATGTCTTTCTCCTGTTACTCTAATCTTAGGCCCCCCCTCCCCCCTTTTTATCTTTCA
CCATACAGAAAGAAAAATCTAAATTATAAAGTTAAAAAAATAATTAAAAAAAGGAAATGG
TATTCTTTTAACTAGAATAAATCTGTCAACAAAAAGGTACAGGCTAGCTGCACTAAATAC
CCTCTGTAGGTTCTTATTAAAAATATAAATTAAAGTCCAGCATAGTCCCTTAACTTCCCA
CATCTGTTTGCTATTCTATCTCCATTATTAATATTGTATCGCAGGGCCTCCATTCAGGCA
AGATTAATTCCCTGTTCCCAAAGCCTTCTGCTGACACTGCAATGGATGCATTGGAAAGCT
GTAAGGGCAGGACCAGACATTGCTCCAAACACGTGACAAGAGAGAAGATTAATAAGAAAG
AAGAGGAAGTTAGGTTGGGCCTATGACCTGAGAAGCAGTATAGACCAATGGTTAAGAGCT
CAGACTTCAGACTCAGACAGCCAGTTCAATCCCAGTGGCTTTGAGCAATTCATTTAACCC
CTCAAGATCAGTTTCTTCATCTATAAAACAGAGATAACAAGAGAACCTGATAAGATTATA
AAGCATTTAACAGAATGACATGGAAGATAGTAAGAACTAAAACAAAGAAAAAAAGTCTAT
GAAAGTCTTCCTTATTATCATACCACCACCATCTCCAGAATCAGCCTCTACACTGAAGCA
GGACAGGAAGAGCCCTGCTCCTACTCTTTCAATCTGCCCAGGCTAAGTAGCTGCCATAAA
GATACAAAAAAGATCGTATAAGAGGCAAAATACTACAAAAAGCAAAAAACAGAAGAGAAT
ATGACAATATAAATAAAATCAGCTCTTAATTAACCACGCTAATAAGAAAGAAGGAAGATT
ACATTTATTTTTTGAGATGGAGTCTCACTCTGTTGCCCAGGCTACAGTGCCATGGCATCA
GCCTAGCTCACAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved