Microcebus_murinus Locus Mono:160:SNORA9
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:160:SNORA9
Microcebus_murinus
Mono:160:SNORA9
scaffold_36988
SNORA9
1001..1128
2128
GGTCACTAAAACCTAAGGCAACTCAGAATGGGCTTTGGAACAAGGCTTGGTCAGGGCAG
AGGGGGTTAAAGAATAAAGGGTTGGACACTTACCATAATAGCATTTACAATATCATTACT
GTTGTTCTTTAGGGCTCGGACTGCCTTTGCTCTCGACACATTTGCTTGTGACATGACCAA
TTCTATGTCTTTAACTTCCACACCTGTTTCATCAACCTGGAAGTGAGGGGAAAAAATGTA
ATAAATTAAAAAACTTCAACAGTTCTTTGGAACCAGAGTTTCTTGAATCTAGTTCTTAAT
TTAACTCAAAAATCATAACTCCATGCTGGGAGGCTGAGGTGGGCAGATCATTTGAGCTCA
GGAGTTTGAAACCAGCCTCTGCAAGAGCGAGACCCCATCTTTACTAAAAAAAAAAAATAG
AAATTAATTGGCCAACTAAAATATATAGAAAAAATTAGCCGGGCATGGTGGTGCACGCCT
GTAGTCCCAGCTATTTGAGAGGCTGAGGCAGAAGGATCACTTGAGCCCAGGAGTTGGAGG
TTGCTGTGAGCTAGGCTGCTACCATGGCACTCTAGCCCGGGCAACAGAGTGAGACTCTGT
CTCAAAAAAATCACAACATCCTCCTGTTCTTTGAAGACTAAAAAGAAAAAAACAAAACAA
ACAAACAAAAAACCCAGGCCTGGCGTGGTGGCTCACGCCTGTAATCCTAGCACTCTGGGA
GGCCAAGGCAGGCGGATTGCTTGAGGTCAGAAGTTTGAAACCAGCCTGAGCAAGAGCGAG
ACCCTGTCTCTACTATAAATAGAAAGAAATTAATTGGCCAACTAATATATATAGAAAACA
TTAGCCAGGCATGGTGGCGCATGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGCAG
GATTGCTTGAGCCCAGGAGTTTGAGGCTGCTGTGAGCTAGGCTGACGTCACGTCACGGCA
CTCACTCTAGCCTGGGCAACAAAGGGAGACTCTGTCTCAAAAAACAAACAAACAAAACAA
AAACCAACAAAAGTATAGATTCTTATACTGCTTGCCAGAACAGTTTTGAAATGGTCTGAG
GCCTTGTCCTGTTCCATCCAGAACAAGGTCATAGAAATTTTAGAAAATTAGTCAAATGGC
ATGGCTCACATGGTAATCCTAATCCTTAATCCTAACACTTTGGGAGGCTTAGGTGGAAGG
ACTGCTTGAGGCCAGGAGTGGAGACTAGTCTCAGCCACATAGCAAGACCCCGTCTCTACA
AAAAACAAAAATTAACTGAGAGTAGTGGTGCACACATGTAGTCCTAGCTACTTGGCTACT
TCCCAGCTATTGGCTGATGGAGGATGGCTTGAACCCAGGCATTTGAGGTTGCAGTGAGCT
ATGATGACGCCACTGTACTCTACCCAGGGTGATAGTGAGACCCCATCTCAAAAAAGAAAA
ATTCTGGACAATTGAAAAAAAATTTTCTGATATACCTCTTCCTCTTCACTCTCCTCTTGT
ACAGTTGGAGTCTGTGTGTTTTCTTGAATGTTTGAAACAGCTTCACCTTGAACCTTGAAT
TTCTCAGCAGCTGCTAGCTGTGCCTGCTGAGACAAATCCTCGATCTACAGGAGATAACAC
AGATTCACATCAGACTACAGTAATTGAAAAATAAATCATATGTATCTTCAAAATTCTCTA
AACCACCCTAACAATATTTGTACCCCCATAATATGATAAAATAAACAAAACAAAACAAAA
ACAACAACAACAAAAAAACTCTAAACCTACTTCAGGTAACTTATATATAACTTCAAACTG
CTTAATCAATACATGAAAGACATACATTTTAATAATAATAAAAAAAAATAAACTGCTTGT
CCTTACACACATATATATCACAGTAGAAAGAGAAGTAGCCTAGGTCTAGAGCAGTGGTTC
TCAACTGGGGGGAATATTGGGTCTCCCAGGGCACATGTGGTAATGTCTGGAGATTAATTT
TTTGGCTATCACAAATGGATGCAATGCTGCTAAACCGTCCAAAATGCACAGAATAGCCCT
TCCATAGAACTATCTGACCCAACATGTAAGTAGTTGTGAGGTTGACAAACACTGGTCTAG
ATCAACTTCCAAGAAAATTTGACTCACCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved