Microcebus_murinus Locus Mono:168:SNORA61
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:168:SNORA61
Microcebus_murinus
Mono:168:SNORA61
GeneScaffold_2257
SNORA61
1001..1124
2124
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTATGCCTAGCCTTCCTAGTGTCTTTGTGTTAAATCTGTACCATGAAGCAAGCA
CTCCCAAATGCTGCCAGCAGGGGTATAAACCAGCACAACACACCTGCCAGACAATGTAAA
ATGCTCATACCATCAGGTTCAGTAATTTCACCCCTATGAATTTATCCCACAGAAGCATTT
GCATACATCTGCAATGATACAAAGATGCTTACAATGAAGGAATTAAATTATGGTGCAACC
ATATGAGACAATACTACATAATCTTTAAAAAGAATATAATTGCCCTCTAGTTCCCCTTCC
CATCATATCTGAACACTGGTCTTTAGTGGTCGTAAAAGTAATACTGAAGCTGGTCTAGCA
GTGTTGTAGTTTGGTATATAGCATGTGGGATAGTTTCAAACAAGGTAAAAAAAAAAAAAA
AAAGAATGTAATTGCTGTAAAAAGACATCTCAGATACAGGTAAGTGGAAAAAGTACAATC
CAAAAACTATGTATATAATCCTACTGCTATAAACATTTTTTTTTTAATTTGTTTTCTTCT
CTGTATCGTTCCAATTTTAGTATATGTGCTGCCGAAGCGAGCACTGCTATAAACATTTTA
ATAAAGATGTCAGTATAGGAAATGCACAACAAAGTATTCATGATGGTTACCTGTGGGACA
TGAGATTACAGGGGATTTTAACTCTCTAAGTTCAATTTTTGAATTTTTAAAAATAACTAT
GCATTATTTTTGTAAGCAGAAAAAATACACGTTTTCTTATACTATCACCTGCATCTAGGA
ATCCCACCATCCTCACAACCACCTTTGCTGATAGCCAAGAGGAGATTGGGGATGGAGGAC
ACTCAGCAATACTAGCCTAAGTGCCACAGCAGAACATGGCCCTCCCTATCCCTGGCCTCG
GCTCAGGTAAGTGGACCCTGCATCCTCCAGTCAGATCTGATTGAGGCCCCTCTGAGGGAA
GGACAGGGGCTGTCCAGGGGTGTAGCTTAAGCTGGTTATGCCAGCACCTTTCCTTAGTAT
CTGCTAGTAACTAACACTTATATTCGTAGAAGATTCTGCAGATCTTTCTAGATTATGCTT
CCTAACATGAGGGTAGGAAGCAGCCAGACATCTAGCCATGTCTCTCTAGAACTTCCAAGC
AGTTCCCTAATCCAAAAAATAATGAAGGCCTGTTTTGCCAACTACTATTCCACAAAGGAT
CTCTCTGGCCCACTAAGCTGCACCCAGAAAGAGACACATCTGTGGTTCTAATATGGGGAA
GAGGCGAGGCCCTGAGGGAATAATCCTCTTAGCAAAGTCCTTCCTTTACCCAATTCTTGT
CCCCACCCCAAATCCAAAAGCAAAAACACACATGCTCAGTTCAAATACTAGGTAGCATGA
CTTTTCATGGAGCTCAGCCCCAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved