Microcebus_murinus Locus Mono:185:SNORD60
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:185:SNORD60
Microcebus_murinus
Mono:185:SNORD60
GeneScaffold_282
SNORD60
1001..1083
2083
TCCCGGCGCCTAGAACCGTGCATGGCACCCAGTGAATGCAGGAAAAAGGAACGAATAAA
GAATGAGAGAAAGAGGGAAGGAGCAAGCGACGGACGAGCTGACAGGCAGGGAGACTGACC
GACGCAGAGACCCTGGACGTCCAGCCCCGCCCCCCAGCCCAAACCTCCCCCACGCCGGCC
CCGACGCGCCCGCCTGGCCCCACCGCGCTGCCTCGAGGCGCGAGCCCCGATCCGGGCGCG
CCGCACGGACACTCACCCGCCCGCAGCCGCCCTGGAGCGGCAGCGCCACCCCTCCCGCTT
CATGGTGCCCCTAGACAGCCGGCCGGGAAATGGACAGAAGCGCGAGCCGGAAGTGCTCGA
GCGCTGCGCCCGCCGGGACTTGTAGTTCCGCGGCTCACGAGGCCCGAGCAGCTGCCTCAC
GAGCAGCGCTTCGGAAACTACGACTTCCGGCGGCCCCGTCGCCGCGGGGCGGGATTGGCG
GCTTCAGAATCACTCTATGTTGCAGTTCGGAGTCTGATTGGCTGTATCTATTTGTCGCTC
ACCGCTCGGCGCAAAGGACTCTGCAAAAGGAGGAGCTTCGGGTCACCGCCTGAGAGACCA
CCTCCCTAAAGAAATGCCATGGCACGATTGGTGGAAACAAAGCTATAGAGAGTGGAGCGT
ATCAGCGGCAAGGGAAGGCGGGCACTTCCGCTAGGATTGCCCAATCACGGAGGTGATCTT
GTTTCTATAAAGGCTTGAGCCTCGCGCGCGCTCAGTCTTTTGGGATTAAGAACGAGATAA
AGTATGCTGTTGTTTCGTCCTGATTTTTCACAATTCAGGGACCAGTTGGGCTCCCGGTGG
GGTTTCGAGGGTAGCCCGTACCTTGCAAGACTTTGCTGGACAAAAGCCCTGGCCTCAGCT
CGCCTTGGCCCTGAGAGTTTAAACGTCTCTTCCCGAGTTTCAGACCGTCAGCGCCCTGCA
GGTAAGACTGGGCCAGGCCTGTTTTCCGCGCTATAGCTCCGAGCCTGTGATGAATTGCTT
TAATTTCTGACACCTCGTATGAAAACTGCACGTGCAGTCTGATTATTTTGCAAGACTGAG
GCTTGTGGTGCGCACCTTTGGTGGGAGGGTTTGGGAGTGAAAAAGAGTCTTAACCGAAAT
GGGGAAGAGGAGACTCTGTCTACATTTCGGTGCTGTCTGACTTTCAGGACCGACGTGAGC
CGGCAGCAGATCTTGAATCTGAATCAACCTTAATCCAGAGGCCCAGCAGGCAGGAGGGCC
TGGTGGTAAGGCAGACGCGCTGTTTCTATCTGAACTGGTTAGAAATAAAGTAGCGGCAGT
GAGTTTGTTAGGTAGGGCTAGGGGCATGCAGGCGACAAGGGGAGGTGGCCAGGGGTAAGG
ACTGATAAATCAGAATAGAGAAACCATAACAGCAGGAACTTGAGGTTAGGGATCTTTTCT
GACTGGGGGCATGCGCAAAAGCTAGGAGTTCATGACAGAAAGTAAACTTTCTCATTAGCT
TAGTAAAATTCACATCCCCTGCTGATAGGCAGAGTTAGTGGTTGCTGAGGCCAGCCACTT
CCGCCATGATTGCCCTACATGAGGGCTCCTCAAACTATGGCCCACAGGCCACATGCCGCC
CACCGAGGACAATTATCCGGCCCGCTGGGTGTTTTTGCTGCCGCTGCCTGTCCTGCTTAG
CAGCCAACTCGTCCTGGGCCAACAGTGCCCATGTGTGAAATGTGCGTTGCCCTCTCTGAC
TCCCCTCCTCTTTGTCTCTTGACTCCTCTCAGTCTCAGGGTGTGATCGGAGGAGTCACGA
GCTTGCCTGTGCAGAGCCTGCTGCTGTCTGAGGACAGAGGTAAGAACAAGTTAGGATTAA
CTTATTTTTTTTTAAGTTAGGAGGTGTATTTTTTTTTTATTTTGCAGTTAAGGGGGGGGG
CTTTTTCCCTGAAGTTAGGAGGCTTTTTTTTTGCAGATGGGGGGGTGCCTTTTTTTTTTT
AAGTTGGTTGGTTGGGGGTGGTTTCTAAGGGGTTGCATCACAGTGGTAACGCAAATAGCT
CTCAGTGCTAATGCAAATGGTCAGTGCTCGGTGGTAATGATATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved