Microcebus_murinus Locus Mono:19:SNORA61
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:19:SNORA61
Microcebus_murinus
Mono:19:SNORA61
scaffold_55853
SNORA61
1001..1128
2128
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATTATTTTCATC
AGCACATGGAACATTCTCCAAGATTGATCATATCTTAGGCTATAAAACATATCTAAACAA
ATTTAAAAAAATAGAAATCACACCATGTATCTTCTCAGACCACAGTGGAATAAAATTAGA
AATCAACTCCAAGACAAACACTCAATTGTACACAAAGTCATGGGAATTAAACATCCTGCT
GCTGAACGATTATTGGGTCAATAATAAAATTAAGATGGGAATCAAAAGATTTCTTGAACT
GAATGACAAAGACACAAGCTATCAAAATCTATGGTATTCAGCACAAGCAGTCCTAAGGGG
AAACTCATAGCCTTAGATGCCTACATCAAAAACATAGAGAGATCATAAACCAAAAATATA
ATGACATGTCTCAGAGAACTAGAAAAAGAAAAGCAAATCATACTCAAGGCCAGCAAAAGA
GAAGAAATAACTAAGGTCAGAGCAGAACTAAATGAAATGAAAAACAATAACAGAAAAAAA
AATAAACAACAATACAAAGGATCAATGAAACAAAAAATTGGTTCTTGAAAGGATAAACAG
AATGGATCTCTTGCTAGAATAATAAGCAACAGAAGAGAAATAACCCAAATAAGCTCAATC
AGAAATGCAAAAGGATCTTGGTGGTCATAAAAGGAAGAAAAGTAATACTGAAGCTGGCTT
TGTAGTGTTGTAATTTGTTACATGGCATGTGGGCTAGTTTCAAACAAGTTAAAAAAAAAA
AAGAAATGCAAAAGGAGATATTAGAACTGATGCCACAGAAATACAAAATATCATCTGTGA
ATACTATGAAGATCTCTACACACATAAACTAAAAAATGCAGAGGAAATGAACAAGTTCCT
GGAATCACACAACCTAACAGGACTCAATCAGGAAGACATAGAACTCCTGAACAGACCAAT
AATGAGCAATGAGAATGAAGCAGTAATAATAAAAAGCTTCCAACAAAAAAGTCCCAAACC
AGATGGATTCATACCTAGATTTTATTAGATCTATAAAAGAGAGCTTGTACCATATTTCAG
ATATTATTGTGTAACATTGAGAAGGAGGGGATCCTTCCCAATTCTTTCTATGAAGCCAGT
ATCGCCTTGATACCAAAGCCAGGAAAGCAAACAACAACTAAAACAACAACAACCAAAAAA
ATAAAAAAACCCACAGACCAATATACTTTATGAATATAGATGCAAAACTCCTCAATAAAG
TACTAGCAAACCAAATTCAACAGCACATGAAAAAAATAATACCCCGGACCAAAGTGTGTT
TCATCCCAGGGATGTAAAGATGGTTCAGGATACAAAAATCAATAGAAGTGATTCCCACAT
AATCAAAGCAAAAGCAAAGACCTTATGATTATCTCAATAAGTGAAGAAAAAACATTCGAC
ACATTTCAGCCCTCTTCATGATAAAACCCTCAAAAAACTAGGCATAGAAGGAACATGTCT
CAAATTTATAAAAGCTGCATATGTCAAACCTGCAGGGAACATCATAATGAATGAGGAAAA
GCTCTGAGCACTCCCACTAAGAACTGGAACAAGACAAGGGTGCCCACTGTCACCACTTTT
ATTAAACATAGTGCTGGAATTCATAGCGAGAGCAATCAGGCAAGAGAAAGAAAGAAAGAA
AAAAAAAAAAGTATCCAAATCAGATAAGAACAAGTCAAACTATCATGTTTTGCTGAAGAT
ATGATCTTATATATGGAAAATCGAAAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved