Microcebus_murinus Locus Mono:97:SNORD75
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:97:SNORD75
Microcebus_murinus
Mono:97:SNORD75
scaffold_959
SNORD75
1001..1059
2059
AAGCAAAGGCTAAAGCACATTTGTAAACTGCCTGGCTGATTGTTGAAGGAATGTCCCAG
CATACACATAGTGTATTTTCAAAGACTGGCAAAATTTTTGTTTCCAGGCATTAACAAAAT
CTCTGTCCAGTCATTCACTAACCATTAAGCTATGCCAGTGGTCATGTATTACAAAGAATA
TAGACTTTACAAAATTAGTTTGGAAAAGTCACCAAACAGCAACTACAGCAAGCAGAAAAA
ACAAATCATGCTATGATATGCAAAATGTCCAGTTATCAACCAAAAACTACAAGGCTTGCA
GAGGAACAAGACAACATGACCCATACAGAAAAATAAATCAATTGAAATTGTCCTTGATGA
AGCCCAGACATTGGACTTACTCCAATCAAAAGACAGACACTAGCAGAATGAATTTAAAAA
ATCATTTAACTATAAGCTGTCTATAAAAGACTTAGTTTAGATTCAGACACAAATAGGTTG
AATGCAAAACAATACAAAAAATATATCATGCAAACAGAAACCAAAGGAAGCTGGAGTGAC
TATATTAATATCAGAAAAAAAATAGCCCTCAAGACAAAAAGTATTATAAGAGACAAAGAA
ACATATTATACAGTAATAAAAGGGTTGGTCCAACAAGAAGATATAGCAAATATAAATATA
TATGCACTTAACATCATATCCCCAAAATACAGAAAGAAAAAACTGTCAACATTGAAGGGA
AAAAGAGATGATCGAACTGGTCGTAGTTAAAGATATCAATATCTCACTTTCAGTAATGGG
TAGAACAAGTTGACAGAAGATTAAGCAAATAGAAGACTGGAATAACACTATAAACCAACT
AGACCTACTCTCTGCAACAACAGCAGAATAAGTATGTCAGGTGATAGATTTGTTAATTAT
CTTGATTTAATTATTCTCGAATGTAAACATATATCAAAACAGCATATTGTACCCCATAAA
CATATACAATTATTTTTTTGTCAATTAAAAGTAAAATATGAAGCCTGTTATGGTTTAACA
GTAGTGACAGAAGGAACTTCTGAAATTCTATTCTAAGGCTTTAATGTAAAAACAAAATAA
AAAAATAATTATTTTAAATGCTTACATTAAAAAAGAAGATATTGTAAATAAGTATCTTAA
CCTTCAAACTTAAGAACATAGAAAAATAAGTGCAAGCTTAACCCAAGGTAGAATAAAGGA
AATAATAAAGATTAGGGTAGAGATAAATGAAAGAGGATAGAAAAAGAAGAGGAAAATGAA
AACAAAAGTTAGTTCTTTGAAAAGATCCTTAAACTTTTAACATGAAATCTAATGAAGTAA
ATGTTTTATCATCCCTTTTTTACAGAGGAACGCAGGGAAGCACAGAGCAGCCCATCCATT
CATTAGCTCAGCAGTTAGCAAAGCACCTGCTTTGTGCCAGGAGCGGGGGAAGGCTCTGGA
GGGACGACAGCTGAGAAGAAGACACACGCTCAAATAGCACAGCTCAGGGGAGTCAGACAC
ACAACAATGTGTGACTCTAAAGGCAGGCCTGTGCTGCTCTGGGGGTTCAAGAAAACCTTT
CCAGAGGAAGTGAGGTATAGATGAGTTCCTGATGGTTTGAAGGAGGTCTTGCACACGGAG
TGCTGCTGAGCTGAACTTCAGCCCGTGGAGGCCTACCCAGGTTTGGCCTGCAGAGCTGGC
ACAGGGGCCTGGGCCTGGCCGTCTCTGCCACACGTGCAGAGGGTAGCTGGCCTTCCTTCC
TGGGCCTCTGCTCTCCATGTGGAAGTCCCTTCCTCCCTTCCCCCCACTGTTCTGGGAAGG
AGGCCAGGTAGGAAGAGCCCTCTCTTTCCCAAGGTCTTGAGTCCTTTGGACAGGTCCAGT
TGCCAAAAGACTGAGACACCCATTTTTGCCTGGCCTCAAGGGTGGGCATGGAGCCCTTGT
GACCTCGCAGCTGAGCAGGTGCCAGGACAGCAGGGGAATGGGATGGCTTCTGCCTCAAGG
TCACATCCTTTGGACCAGAGTCTCCTCACTCAAGGAGCCACTAGTGGCTGGAGACCCAGG
AACCAGGGCTGTCTCCCTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved