Microcebus_murinus Locus Mono:161:SNORA4
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:161:SNORA4
Microcebus_murinus
Mono:161:SNORA4
scaffold_10717
SNORA4
1001..1141
2141
AGTAAAAGAGATTAAAGTTAAGGGTAGTCAAAAAAGCTCGAAATTTCAGGGCAGGATAC
CAGAAAGAGGGGAGCTAAACAGAGAAATGGTCTAATAATATGGAGTTAAGACATCCCCCT
GATTTTCTGGCTCAATAAAAACTCAGGTATGCATAGGAAAAAATTCAGACAAAGCCAGGC
AAAGAACTACTAGGGAAAAAACTGGGGTGCTACAAGCCAGATAATTCCCAGAACTCACAC
AGCGCTCAGTTCCCATCAGTCAAACTAGAGAGGGTTTAATGGATACATGAACATTCAGTA
GTCACTCTGAGAGGTTCACGATTTAAAAGTGGTGCCAAAATTCACAGTTCAGAATTTAAT
TTAAAAAATTACTAGACTTACAAAATTGCAAAAATACATGTACTAGGATCAGTCAATAGA
AACAGAACAAAAAATGACTACAAAAAAAAGGATAGGATTAGAAATAAAACCCTAAAACAG
CTATTATACATTTAAAAAAATATGCTCAAAGATTTAAAGGAAAACATGAACATAATTAGA
AAAGAAACAGAAAATATAAGAAAGAACAAAATGGAACATCCAGAGAGAAAAAAATATAAA
ATATGGAGTAAAATAAATCACTAAATGAGATTAAAAGCAAATTAAAGGCTGGGCATGGTA
GCTCATGCCTGTAATCCTAGCACTCTGGGAGGCCAAGGTGGGAGGATGACTAAAGGTCAG
GAGTTCAAAACCAGCCTGAGCAAGAGTGAGACCCTATTTCTAATAAAAATAGAAATAAAT
TGATTGATCAACTAAAAATATATAGAAAAAATTAGCCAGGCATGGTAGTACATACCTATA
ATCCCAGCTACTCAGAAGGTTGAGGCAGAAGGATCACTTGAGCCCAGGAGTTTGAGGTTG
CTGTGAGCTAGGCTGATGCCACAGCACTCTAGCCGGAGCAACAGAGTGAGACTCTGTCTC
AAAAAAAAAAAAAAGCAAATTAAACACCTAAAAATAAACATTTACCAAAAGGTAATTTGG
TTGGAGAGAGGTTGTTAAAATAACCTTTACCAGCTTGGTCTATTTGGGAGAATAAAGAAA
TATTCTCTCCACAGTGGCCTGTACAACTTAGTATAATTTACTACTACTTTATGGCCTATA
TTACACAAGGGAAAGAGAAAGAAAAGAAAAGAAAGATCAATGACCTTTAGGCATAGCAAT
AGAAACTTAGAATTAAAGCAAAGAGTGAAAAGGAAAAAAGAAAAAAAAGAAGATAGAAAA
GGAAGAAGGGAAGAAGGAGAAAAAAAAAATCTTCTGTGACCTGAGAAACAATAGCAAATG
ATCTAAAAGTTGTGTCATTGGTTTTCCAGAGAGAATAGAAGGAAAGATGTTATATTCAAG
ATTCACAAGGCCGCAGGACAGAGAGACAGAGTCACCAAGGCTGTAATTATCAAGAGGAGT
TTTATTGTCTAGCTCAAGCTAGGGTCCGAGCCCCCAGAGTGCCAGTGCAGTGGCCTCTTC
TTTGGGCAGGGACCCTCCTTTGTGTGTTAGTGATTCTTTTATAACTCAGTTGTCTACACA
CTGGTCATGCATCCACACCCACAGTGATTTTTACTTCATCCTGCCCCTGATAGGCTCTAA
CCTGTTCCAGGTCCTAGCTAAGAGACTCCGGTTTCCGTGTTCTTTGTCTTTCTCCTCTGC
AACCCATAATGTACTCATAATGCCTTGCGGTTAGCAAACAAGCAGTAAACAGAAGCTGGA
AGGTGTCCATTGTCCTTATAGCCCAGTATCTTACAAAGAAACAGAAACATAAAAAATAGC
TGAAAAAATAATAGCCCAAACTTTCCAAAATTTGATAAAATCTATACATCACAGATCCAA
GAAGCTCAACCAACTCAAAGCTAGATAAAAACACACTTGCAAAAGAAAATCAAAGTATAC
CATAATTAAATTGATGAAGCCATTAATATAAAACCTTACAAGCACCCAGGAAAAAAAGAA
ACATATAGTCAGAGAAAATATAAGAATTATTATAGATTCTTGTCAGAAACTATNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved