Microcebus_murinus Locus Mono:4:SNORA61
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:4:SNORA61
Microcebus_murinus
Mono:4:SNORA61
scaffold_82
SNORA61
1001..1132
2132
GGACTCGGGATGGCAAATCAGTTTCACCGCAGGTGTCAGCCCTGATTGCCCGTAGGCAC
AGCCAGGCCGGCTGCCTGGAGGTGGCGGTATGCGGTGTGCTCAGCGGAGTGTGCCATGCT
CATACGGCACGTGGGCAAAGGTGGTTGTGGGTTGAGACGTGTCCCTTCCAAAAGATATGT
TGAACTCCTCATCCCTAGTACCTACGGATGGGACCTCATTTGGAAATGGGGTCTTGACAA
GTGCGGTCAAGTTAAGGTGAAGTCATATTGGCCTAGGATTGGTGTCCTTACATGAAGAGT
GAAATTTGGGCACAGGCACGTGGAGAAGAGAAGCCCTTGTAAAGACGGAGGCAGGGATAG
GAATGATGAGTCTACGAGCCAAGAAATGTCAAGGATGGCTGGTCACTACCAGAAGCTGGG
AGAGGAGGCTGGAACCGATCCTTCCCTAGCTCCTTCAGAGGGACACCTGCTGACACCCTG
ATTTCAAACTTCTCGCCTCCAGAACTGTCAGAGAATACATTTCTGTTGGTCTGGGCCACC
CGGTCGGTGGTACTTTGTTACAGTGGCCCTAGAAACGAATACAATATTAGACGCTTCCAA
ACGCAGGATGCAGGATGGTTAAAATGATCAGTCATTTTAGAAGACGTCCCCCCATCATAA
TCACTGCAGGCACTTTCCTGGAGTGAGCAGGCCATGGGGATGGTGTGCCCCAGCTGGAGA
TGAGGCAGGGGACTGGGGTGCTCTGCACTGGTTGTGACCGGGACATCCTAGTGGTCCTCT
GGCATGGCAGGTGTTGATGGTTCTCAGACACTTATATGCCTGGATGGGTGATACTGTTTT
AACATGTTGAATTGCAGTTGTACGAATGCATTTAACACATTCCACTTCTTAATCCCTACA
ATGAAACAAAAAAAACAAAAAATGTACCCAGAAGCCATTGGTGATAGATCAAGTGTAGCA
AAAGGAACAAATAATCTGCCAGAATTAAGACCCAAACTCTGGCCCTCCAGTTCCCTTTCC
CATCTGATCTGAACACTGGTCTTGGTGGTCGTAAAAGGAGGAAAAGTAATACTGAAGCTG
GCCACGCAGTGTTGTAGTTTGTTATATGGCACGTGGGCTAGTTTCAAACAAAGTAAAAAA
AAAAAAAGACCAAACTCTGGAAATACCATTAATCTGGCACTGGTGAGGTTGCAGACAATC
AGGACAAGAGATCATCAGTGGTATTCACCCTTAGTCTTGCCCTTTTTAGTTTCCTTCTTT
GAAAATGCAGACAGTCCCCGAGTGGGACCACATGAAACAGTACAATCATGGCAGCCTACA
CACTGGTCTGAAAAAAATATGGTCTTTGGAGTCAGACAGATGTGAATTGGAATCCAGGCT
CTGTCATCCACTAGTTCTATGGTATTAGGCAAGTCACTTGACCTCTCAGTGCCTTGATTT
ACTCATCTGCTAAACGGGTGTAATAATATTCTCACAGACTTGTCGTGAGAACTAAATGAA
TTGATATTCGTGTGAAAACCAGGTCTATAGTGTGTGCTAAATTATCAGTAGCGTTTGCTT
CTGCTCACTCAGAGGCTTTCTTTCCTTGGAGAGCGAAACCTGGTGGTGTAGGCGGGGCGA
GCTGCAGTGGAGGCAGAGGGTGAGGCTGGGGGGTGACGCAGCGGAAGGATGCACAGGTGA
GTCTGCCATGGTTTCCTTCTCCCCATGGCTTGAGCCAGCCCCTCCCAGGGCCTTCCCTTC
GTCCCGGTCTAGGGTCCCCCAGAGCGGGCGCAGTGACAGCAGCCCACCCACAGTGGGCAG
TAGCCAGCAACCTCTCTGCCCCAGGGCCCCCTTCCTGGGGACCCAGAGGTGGGGCACAGC
AGGGGCGGCTCAGGCTGCCACGGCATCCTCCTGGGGGCCGCGCAGCACAGAGCCAGGAAG
CAGACGTTGCTCTGTTGCTCCCGTCAGACAAGGCCGCACACTGAACACCAGCTTTAACTG
AACTGGGGGCGAGGGAAAATCAGCAACTTAACCTGCTCTGAAAGTGATCTCTTAATCCCA
GTTTAAATCCATCAACCCCGATTTACCCGGACAGAGACCATCTTCCCCAGACGGCTCAGC
ATCTTTTCACTTTTCTTTTTTTTAAATGCTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved