Microcebus_murinus Locus Mono:311:SNORA40
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:311:SNORA40
Microcebus_murinus
Mono:311:SNORA40
GeneScaffold_51
SNORA40
1001..1126
2126
AGGCAAATGGTTGGACTAATGACTGCATTTATGCATTTATAAATTGAGCACACATGTAA
GAAACAACAACCCATCAAATATGTCAGCTTCATTGCAGCTCCATTTAAAAAAAAAAAAAA
AGTTTTAAATGACCAGGTTACCAAAAAAAAAAAAAAAGTGTAATTTTCTACTGTATTATT
GCCTGTGAAATATTACGAGTGCGAAATGTAATTACGTTAATGCTATTTTTGATATCATAT
CAGCAAATTATGCCGAGTCCCACTGTGACACTTCTATCAGGGTAAGCATTATCCTGTTGT
GAGTGTCGATCCCCGGGGAAAATGAAGTCGCTCAAACGGTTCTGATGCTCCAGCAATTAG
CCACCTCGAGACTGCAAGGAAAGGCTGATTTCAGAGCCAGTTATGGAATGTTTAACCTCT
AAACATCTAGGCGACTTACCTCCTGTTTATTTTTTTCCCAATTAAGCCCCAGAGAATCCT
CTTTATGTAAGCGAAGAATCGTTTTATATAATAAGAACTTTTCTACCTCTATTTTCCTTC
TTAATCATCAGCAAATCCCCTTCTGCTATTAAAATACACACCACGAAAAGTGGAAAAAGA
GCTGATAAGTATATATTGTGCTGAGGACTAATACTCTAATGCCACGAGGAGAAAAACACA
CACAATGTGATATGTTGGAGGATTAGCTCTCTTCACATTGAGCAAACAAAAATAATAACT
TCCAGCATCCTTTGGAGGCCAGTGATTTATTTTTCTTTCTTAGGTTCAAAAGCCTTATTA
GAAGATTTTAAATGATGCAAAAACAAAAAAATCACTCACTCAAGCTTTGTAAGATACCCA
TTTACTTTGGGTATAAAAACACCATTGCTGAAGTCAGATCCAACTTACAGGTTTTAGGCA
GCTGTCTGGGCAAAATTATTCCTCTGGGCATTTAAGGGACCAAATGTAATGCAGATTTTC
AAATAATTTTTCTACCGAAACAAAGGACTCCATCCTCATCTTACTCTTACTGAGCTTTGT
TAAAAATTGATTGGAAAACTTACAGACAGGTGCAAAAAATAAATCCTCTTTTGCAACCCA
GAACTCATTGTTCAGTATGAGTTTTGATACATATAAGAAGGAATATTAAAAAAAATTTAA
AAAGAAGGAATATTATAAAAAGAAATTAATTGGAAAGACCTTGTGATATAAACGCAATAG
AAAGTTGTTAATATAATTTAGACTTTTGATTGAATTCTGTAAAAATTAAAGTTTTGAGGA
TGGAGATTGTTCATAAAGAACTATTTTATCCATATTGTAAAACCAACCTCTCAGAAAAGG
GAACAATTCCCTTCAACGTGGCAGCCTTTGCAAGCTTAGCTGCAAAGATGGAAACATTAC
GGTCAGTTACTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTAC
TAGATCTTGAGCATCTCTGCATTTTCAGTTTCTATTTTAGGTAGAAAACCACCCCTTAGG
CTGCCATTCCATCTGGAAAATGTAATTAATAAATCATCAGTTCTCAGTTCTGCACACTGC
CTTATACAGCGTACAAGAAAGAGAAGAGAAAAAGAAGATCTAGTTATTAATATTACAGAT
CAGTCCAAGCCCTGCCTCGCAACGCTGTCTTAAATTCCCCTGGAAAACAAGGTGTTTGGA
TTTACATGGGGAAACTCTCCTCTGCACACACAGAATTACCCCTGCTCTTTCCAGCCCTCT
AATCTCCCCGCCTGGATTTATCACACATCTCAACCTTATTGGCTTGAAGCTTGGAGGGAG
AGGCTGAAGAACAGTGCCTGACCGAAGGCACCCTTCTGTGATGATAACCATGAGAAAGCC
AGAGGGAGGAGTACACCCAGCAGGGGGGAGCCACAGGTTCAGGTCCTGGGGCAGCAGAGC
ATCCTTAAATCGAATCAGATTTCAGAGATTCAAATTGAGCCTCTAGTGGCTGTGTGAACT
TGGGAAAGTGACTTGACCTCTCTAAACCTCAGTTGCACTTCAGAGTAGGCGCTGAACTAT
CAGCTCTTACTATGATTAAGATGAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved