Microcebus_murinus Locus Mono:312:SNORA25
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:312:SNORA25
Microcebus_murinus
Mono:312:SNORA25
GeneScaffold_663
SNORA25
1001..1116
2116
GGCAGCCAAGAATACTCTATCCAGCACAATTATCCTTCAGAAATGAAGGAGAAATAAAG
TCTTCCCCAGGCAAGCAAAAACTGAGGGAGTGGCCTTATAAGAAATGTTTAAGGAAGTCC
TACATCTAAAAGCAAAAGGACAATAACTACCATCATGAAAACATGTGCAAGTATAAAAAT
CACAGGTATAGCACATAGAGCAGATAGCAAATAAGAGAGAAAAAGTAATCAACTTTATTG
CTGTAGAAAACTACCAAATCACAAAGACAAACAATAAGAGAGGAAGAAAGTAACAAAAGA
TATACAAAACAACCAGAAAACAATTAACAAAATGACAGAAGTAAGTCCTTACCTATCATT
AATAACCTTAATGTAAGCAGATTATATTCCCCAGTGAAATGATACAGACTGGCTGAATGG
ATAAACTATCAAGACCCAATTATATGCTGCCTACAAGATACTCACTTCACCTGTAAAGAC
ACACAGCCTGAAAGTGAAGGGATAAACAAAAATATTCCATGCAAACAGAAACCAAAAGCA
AGCAGGAGTAACTATACTTACATCAGACAAAAAAGACTTCAAGTCAAAAGTTATAAAGAA
ATACAAAGAAGGTCATTATATAATGATAACAGGATAAATTTAGTAAAAGGATATGACAAT
TCTAAATATATATGCATACAATACAAGAGTACCCAGATATATAAGGCAAATATTATTAGG
TCTAAAGGGAGACATAGACCCCAGTACAATAAGAGTTGGTGCCTACAACATTCCTCTCTT
AGCATTGGACAGATCATTTAGACACAAAATCAACAAAGAAACATAGGATTTAAACTGCAC
TATAGACCAAATAGATCTAGTAGACATTTACAGAACATTCATCCAGTGACTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGTACTCACTGTAGTCCGGGCAACAGA
TGTGAGACTCTGTCTCAAAAAAAAAAAAAAAGATTGAAGTTCCTTATAGGATGCTATAGC
ACTTCATAGTGCTATGTTTTCCTGAGGAGATATTAAATATAAGACTTAGCCACTTATAAT
CATGACATAATAATCCAAGATTGTTGATTTAGGAAAGTAAACAAATGCCTCCAAACAATT
TTTTTAAAAGTGCTAGTCTGAGTGCAATGGTGTTTACAACTAACTGATCACAACCAGTTA
CAGATTTCTTTGTTCCTTCTCTACTCCCACTGCCTCACTTGATTAAGCTAAAACAGTTTT
ACAAAATAAAAAGGAAGTGCATGGTCACTTACAGAGGTGACTAAAAAAATATATACATAT
TGTGCATTTGTAGCTAGATGAATACTGTTAACCAGAAAGTGCTGGCTTAAATATCTGTCC
AACTGCTGTAGGGCTTTTCAGTCCTCAAATCCCTCATTTAATCTGCAGATTATCTTCAGG
AAGGAGTTACAGATGAGGATCTGAGGTTCCTGGCATTAAGTAACTTGCTTGGGGTCACCA
GTGACTGGTGCAGCAAACTTGTTAACACGTATTGGAATCTGTTCTAGCTTCAAACTCCAC
ACTCTTTCCAACAGCTGGCTGCTACCCTAAATATTTGTTGAGGTCTACTCTACAATATGG
AAGGTATGGTTAACCCAAATATAGTGGACAGAAAATAGTCAATGGCTTTCCTGTGAGGTT
TGATGTTCCAAACACATTTTCATAGCATGGCCTACAATCATATTAACAAACACAAAGCCA
TTTCTCTCTTTTATTGCCTAGTTTTAAATCTTATGGGAAGAAATACTGAGGGCCTGAACC
TAGCAGTAGGGGTAGGCAACAAAACAAACAGTATCTGAATATATTGTGATTCTTAAAGGG
CCTTCAAAACAACTATAATCTCTGGGGCAAGTGTACCTCCCTCTATTAAGGAACGGGCTA
AGGGTTGTAGGGTGAGGGCAAAGGCAAGGTAGAAGCATGGGGAAATTGAGCACTCCCCTA
GATTCTCTTTTATCATCTCCAGGATCTACCTGCTGTACAGTCACTAGTTATGGCTCAGAA
AGGAACAAAGAAAGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved