Microcebus_murinus Locus Mono:112:SNORA57
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:112:SNORA57
Microcebus_murinus
Mono:112:SNORA57
scaffold_35731
SNORA57
1001..1149
2149
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGTGTAT
GCTGCCTGGGAAATAGTTTGGTCACTAGAGATCACTGCCAACCTCCTTTACTTGGCAGGG
ACAGAGCATGCAGTCCCGCTCCCCATTATGTATGGAGGCAGAGAGAAAGAGCTCTGGCCC
CTTTGGCACCATGTCTTCGGTGCCAGCAGCTTCCTGTACGCTGGTTCTATCCTCAAGCAC
CAGGATACCAATTTAAAAAGAAAAAGATCAGTGCCAACTCTCTGTGCCATCCTAAGCATG
GAGTCACATCTTTGAAACTTCATAGAGCCCTAAACCTCACAGATAGATTGATAATGCAGT
TTTACTTTGGGAGGGTAGGCAAAAGTCCAGGTCTATATTGAACATTTATTCAAGTAACTC
TCATAGCCATGAGGCAGAGTAGCTCTACTGGCCCAAAGTCACTAATACCTCTTACCCTCT
TACGTTGGGGACTGTATTCTTAATTTGACTGTCCTTACTTTTAGGAGTGACTTTTATACT
TTCAGATGTTTTTGTGTTACTCATTAGTATCCTTTTCTTTCATGTTGAAAAACTTTCTTG
TAAGACAGGTCTGGTGGCTATGAAGTCCCTCAGCTTTTGTTTGGAAAAGTCTTTATCTCT
CCTTCATTTCTGAAGAACAGCTTTGCTGGGTATGGTATTCTTGGTTGGCAGAGTTTTTTC
CCCTTCTTTCAACACTTTGAATATATCACCCCACTCTCTTCTGGACTTAGGTTTCTGCTG
AGAAGTCTACTGCTAGCTATAGGAAACTCCCTTGCATGTTATTTGCTTCTTTTCTCTTGC
TGCTTTCAGAAACCTCTCTTTGTTTCTGATTTTTGACATTTTGATTGTGAAGTCTTTCGG
TAGTCATGTTTGGATTGAATATGATTGGAGACCTTTGATCTTCCTATACCTGGAACTATT
TGATTAAATTCCTGATAGGAACTTTCTTGATCCCTAAATACCTTAGTGGCTATTTCCTAA
GAACAAGGACATTCTTTTTCATAAACATAATACAGTTATTAAAATCAAGAAGTAGATATT
GATATAATGCTAATATTTACTCCACAGACCTTATTCACATTTCACCATTATCTCCACTAC
TATTCAAAGAAAGTCATCTAGTATCGTGCATTAGGTTTAGTTATATCACTTTAGTCTGCT
TTGGTCTAAAACAATTCCTGAGCCTTTTCTTCTTTTCATAACCTTTGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved