Microcebus_murinus Locus Poly:9:SNORD88
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:9:SNORD88
Microcebus_murinus
Poly:9:SNORD88
scaffold_7735
SNORD88, SNORD88
1001..1090, 4075..4163
5163
AGAACATTGGCTGCAGTGAGATAAGAGTGAAAGTATTGTCTGGGTTCATGGAGGTTTTC
CTGAAGGCCTGTCTTGGATTTCAGATCTTCCAAATATCTTTCCGAGGGAGCTGATCATTA
GGTATGGCAGGCTTAGAGGGGATTTCTGGGGACATGGAGTAGGGACTTGTGAGAGGTGAG
GAGAAAATCACTGGGTCAGGACAGGAAAGATGAAAGGGACCCGTAGCATGTAAGGGTTCT
AAGCCATAGAACTGCCAAGTTGCAAATGTTCCTCCCATTGTCCATTCTGGTGGCCACTGA
CCACAGAGGGTCTTAAGCACCTTGAACATGGCTAGTGTGTGTGGGAACTGGGTTTCTAAT
TTATTTTATTAGTTTAACATTTGAGGAGCGGTTGCCTCTTTGAACAGCATGGTCCTACAC
AGTAGATTTGGGTGTTTGTGGTTGCTAAATAGCATCTGACACTCAGCGAGCAGTTGCTGT
GTTGTAGTACTTGGGGGAGAATGAACTCAACAAATCCTACCAGGGTCCCAGGGAGCAGCA
GCTAACCTTTCCCTGTGCAACAGGTTCTGGTGAGTTCGCTTCCCAGAGTTAAAGGGCCAT
GCAGCTTGAAAGTGCTGGGTTGGGGGAGCCCACCTGAGGTGTGGGCAGAAGCAGTCAAGG
AGTGTGCTCATTAGGGTGGGATGTCTAAGCAGGGGTGAGCCGTGCCCTGTCCTCTCACTG
AACTCTGCAGGTGTGCCCTCTGCAGGGCATCTCTAGTCCCATTTTCCACATGGAGAAACA
ATCTCAGGGGCAACTTAGGTCAGTTGGCTGCAGATGGTATACAAGGAGTAACATCCAGAT
TGAGCTGGACAGTCAAGGGTTACCTTAGGGACCTAGCATTAGAAAGCAAGTCCTGAGGAC
TTGCCTCATTATCCACAGGACCCAGGTAGAACGGTTGTTTTTTAACTGGGATCTCTGAGC
TGTCTTCTGCCTAGTCCCCCTTAGGACAGCAAGTGGCACTGGGGCCTCCATGATGTCCAG
CACTGGGCTCTGATCCCCACTGAGGACACAGTGTTCCCCAGGACTTTGACACTTGGCAGT
CTGAAAGGCCCCTGCTCTGGGGAGGGGATGATGGAGGTGCCATGGCTGCCCTGTACCCCA
CTGAAATCCTTCCCCCATGCCCCCTGTTTTGTTCCTTCCTGTCTACAGGTGGCTTCTCCA
GGCATAGGACATCCACTCCACCAATCCCTCTCTAAGATCAACAGGCTGCCTCTTATTAGT
GGTGGCAGTAATAATGCTCACAGATTAATGCTCACCCTGTGCTCTGAGCCAGGTGCTGTT
GTAAGCAACTAGAATTGTTTAACATGCTGACTAACACAGTAGAAAAAAACGATTTTTTCC
TTGGGGCCACAGTGTTTTATTATGAAAATAGAATAAAAACTTTGAAAACAAAATGATCCT
TACTAATTTAATTATTTAACTAAAAATTTTATTTTTTATTGTTTTCTGTGTGTGAGTTAT
ATGCAACTCATGCCAATTTTTACAATACACACCACATGAGTGTTGCATGTGACTCACGAT
ATACTTCCTGAATTTATTTCTGATAATTGAGTATTTTTTCATTCCACAGGTATTTAGTTG
TGTCTGGAGTAGACCTTGAGTGGTCCTGGATGACGACCTCATACCCCCTAAGTATGTGCA
ACAGTGTCTCATTGCCACATGGTGTTCCATTTGATTTTGTTCAAAGGGCTGCCAGGCAAA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAGTGTAAGTCTCTGACCTGGGGTCCAGTGTCAGGAAGTAA
CATAAAGATTTTTGACTTCATTCAAAGTAACCCTGGTGTTCCCACTGAAATTGCAGTAAA
TCTCCGTGAAAAAACACTTTATGATTTTTTCAAATTCTTCATAACAGATGATGTGATTGA
TTACATGGTGAAGGAAACTAATATCTATGCCAGTCAGACTTTACAAAAGGGTAATGTCAA
ACCCCACTCCTGACTAAAAAAGTGGTATGATGTTACTTCTCAAGAAATGGAGTGATTTGG
GGGAGAATTGTTTTGGATGGGCCTCAACAAGAAGCCAAGACTTTCGGACTATTGGTCAAA
AAACATTTTGTATGACAATTCAGTGGAAGAGTTTACATCACATAACCGCTTCGAAATGCT
TCTGAGAATGTGGCATTTCTCTAACAATGAAGAATGTCCTCCTGGTGACCATCTCTTCAA
GATCCAGCCACTTCTTGATCGTCTTTTTGAGAGGGTTTCAGGTTGCTGTAGTTCCAGGTA
AGGAAATATGTATTGACGAAACAACGATGCCATTTCATGGTCGTTTGAGTTTCATGCAGT
ACATAAACAAGTGCTATAAATTTGGAATAAAACTTTTGAAACTCTGCCTAAAAGACGGTT
ACACCTGGAATGTGAGAGTTTACTGTGGGAAGGAAGCAAGATCTGGCATTCCCTTTTGTC
CTCAGTTGTCATGGAGCTATTAGAAGGTTAACTAGATAGTGGGCGTGTTTTGTACACGGA
CAGCAATTACACCAGCGTCTGCCTAGCTCATCGACTCCTTGAGTGCTCTACGTATCTGGT
AGGCACGCTGAGGAGTAACAGGAAGCTAAACCTGCTGGATATAGTGAAGGCAAAACTGAA
CAAGAATGAAGTAACAGCTCAAGAAAGTGACACAGGAGTCGTGCCCAAATGGAAGGACAA
GAGAGATGTGCTCGTGCTAAGTACTATATGTGGCGAAGACAATAAAGCAGTTGAAATGAG
AAAAAGTATTGTAGAAAAACCATATGATTGTCAATTATAATAATTCAAAGGTGTTCACTG
AACTCTCAGATCAACTGAAGGTGTATTCGTGTTCTTCGAGACATGGCATAACGTGGTTCA
GAAAATTAGCCATAGAGCTAATCACAGGATCAGCTTTGGTGAACTCGCTCGTGCTCTACA
GAGCTGTGAACAAAAAGAAGATCTCGATAAAGTTCAAAGAACAAGTTTGCCTCAGACTGC
TCCAGACAGATGAAACACCTCCTGCAGTGCTGTCCCTCCCGATGCCATCTGTGACTTGGT
TCCTGTCACTTGATCCCTTCTGGCACTGCCAGAAGAAGATGTACTGTGTGCTACAAGAGA
ACACAAGCTGAGAAATGGTGGAGATATGCCAAGAAGAGTTGTAAACAGACAGCATGGAGA
TGCAGCTAGTGCAGTGCATACTTTTGTGTAGAATCAATAAAAAAGTAATGTGAAAACTTG
AAAAGGTTCATAAGGGTAAAGTGTTTTTCTTGACTTTTCAGGCTTAAGTATAATTTAAAG
GTGAGTATAAGTAGAAAAACAAAGTTTATTGACTTCATTTAATCTACGTTTTTAGAATTG
TCAATGTTAATTGTAACAATAAGAACATCAACAAGTAATTTTTGCCCAGGTGCCACCAAT
CACATGTTGCCTGCGCACTACATGGCTCCCAAGATACACATGTGAGTCACGTGTTTCACA
AGACCCTCGGCTCAAGACCAGTGTGAGTTATAGACAAGTCACATGGCAGTTAATGTGTTA
ACCTTCATAATCGTGCTACGTGCCAGGCCAGGGGATCATAACAGAAAGTAGGTTTTGGGG
GGCTGGGTTGCAGTGAGATGTCCTATGTCAGGGTTCCTGAAGAGGCTGTACTTGGGGACC
CCCCCATGATGTTCAGCACTGAGCTCTGACTGCCCATGAGAACACTGCCCCTAGACCTTT
GCCACCCAGGAGTCTGAGGGGCCCGACTCCCAAGCGCTGCTGTGTGCGGGCATTGCCCCG
TGCCCTGTGCCTCTTCTGTGTCCTTCCCAGCAGCGTCTCTCTGGGCTCTGCAGTTTCCTG
CCTGGGAGCCGCCAAGGCCTTGGCTGAGAGCGTTGGCGCCCGCCTAGGCAGGCCGGTGGG
GAGCAGGGGTGCCAGTTCTGCTTGTACTACATGTACACTGAGCTGCTGGCAGAACTCCAG
CCAGCTCATGGTCACCTGGATCCTGTAGGCCTATGACCAGGTGGCCAGGCCCTTCCCTGA
ACTCCAAGGAGCCAGTGCTGCTAGCCTGACCCTGAATGCTGTCTTCATCTACCACTGCGA
GCCCATGTAGGGGGACAGCTGTGTGTCACTGCTCACCTGCCTGCTGGTGGCCTGGTGCCA
ACACTGAGTCCTTCCTGATCTTTGTCCCTGGACTACCATGGAGGGACATTCAGTTGCTAT
GCCACTCTTGGTCCCCTCATCTCCCTTGCCGAAGCTGCCTGAGGACTTGCCCTGCACCCA
GGGACCTCAAGCTGCAGCTCCCGCTGCTAAGCCCACTGGCCAACAGCATGGCAGTGCTGG
AGGCCGTCATGGAGAGCCAGGTGGAGGCCACACTGGGCTCATGCTGGGGCCCAACCCAAT
GCCCATTCACCTCACTGGCTGGCTCCTCTGCCCTGACATGACCAGGGAGAAGATGTGTAA
ACAAGCCGGGCGCGGTGGCTCACGCCTGTAATCCTAGCACTCTGGGAGGCTGAGGCGGGC
GGATTGCTCGAGGTCAGGAGTTCGAAACCAGCCTGAGCAAGAGCGAGACCCCGTCCCTAC
TATAAATAGAAAGAAATTAATTGGCCAACTAATATATATATAAAATTAGCCAGGCATGGT
GGCGCATGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGAAGAATCGCTTGAGCCCA
GGAGTTTGAGGTTGCTGTGAGCTAGGCTGATGCCATAGCACTCACTCTAGTCTGGGCAAC
AAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved