Microcebus_murinus Locus Mono:286:SNORA1
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:286:SNORA1
Microcebus_murinus
Mono:286:SNORA1
GeneScaffold_4046
SNORA1
1001..1134
2134
AGGACAGGAAACGGAGGAGTAAAAAACTCCAACTGAGGAGACCTAGGAAGGCTTCCTAG
AAGAGGTGGCATTTCGGATTGTTGTGAAGAATGAGTAGGAGCTCCGTAGGTGTGGAAGGG
GCAGTGGGGCAGGAAAGGGCATTCCAGGCTGAGAGAACCTGATCATTAAGGGGTTGGAGT
GCTTGGAGAACAGTGACAAGCCGGAGGAGGCTGAATCAGCTGGTATGTGACCAGAGGCAG
AAGCAGATGGAGGAAAAGCAGAGGGCAGTCAAGGAAGAGAGTCTCTGAATGATGGGCCGG
GGATTGGGCTTGTCCTCTCAGCTTTTGCTCATTGCGGGCTCCAACGTCTGCCTTGGAACC
TGAGTAGCCAATGTCTAAAGTGCATGTGCAACTACGACAGTGTACACAACAAGGGGTTAG
CGGAAAGTGGGGCAGAACACCCCCAGTGGGTCCTGGGGTCCCAGGAGGCAAAGAGACCCT
TCATTTCAGGATCTCAAGATATAGTTTTTCAGGGTCCTCCTGAGGCTCAGCTCCAGCAAA
TCCTGAAGGTAAACCCTTGTCTTTTGTGGGTTCTAGGATCCCACGATAGTTGTTCTGGAG
TTTGGGATTTTATCTTTCAACAATTAAGTCCCAAACCCCATCACACTTACACTTATTGAT
CTTCCCTCTCAAACAATAACCTTTGCATGGTCAGGATCCACGTCCGTTTGGGTCTTCGTT
GAATCCAGCTTGGAGTAGGCTACATAGAGGTGTCCATATTCAATTACCTTTGATTGGTCC
AACATTGATTTGTTGGGCACCTGCTAAACTCAGACCCTGTGCTAGGAATCAGAGGTGAGA
AAATAAGACACAGTTCCTTAGTGGGGAAGAACAGACACGCCTAGTATGCCACACATAGCC
AATGTGGTGCCCGACCATCTAGAACAAAAGGATGAGGAGCTACTCCAGACTTATAACAAA
GACAGTCACATCTGCATACTATCCTAAAACTGTGGCGGTAAAGCCTCATCTCAAGGAGAT
TGGGCACTGTGGGCCATGGTGCCCAGAAATGGTTAAAGGGGCTAAATTGAGACACAAGTT
ATGGGTCTGCAACACCAAATGTATTGCAGTGGTGACAATGAGAACTGTAATGTTTTTGCT
AAGGTCATGAGTGAAAACTGGATGGAACACAACTTCAATATTAGAAACATATTAAGGAAT
AATACATTTTTTGCTCGTTAGCCAAAATAGTGATATACTGTCTACAATTCAACTTCTAGG
GCCCTAAAGTAAATTATTGGAAGACCTGGAACTCAAATATTCTAGGCTGGAATTTTTTTA
AGTATTTTCTCAGGATATCTGTATTTGAAGTGGAGATAAAAGAAACCTAACCAAGAAAAC
TGTGATAAGGCTGTCTGACACAACGACTGTGTGTTAAAGCATGGGTCCTTCTAAAAAGGC
CTAACTTAGAGATAAATCTTGACTCAAACTTTGGAGGAACTAAGGTGACCATGGGCAGTG
GAATAAATCACAACATGTAAAATTTCTTAAATAAAGAGTTATTGACTTAAACCCAGAAAG
GTGATATTTGTAGTCAGGGGGAATTTTGCAGTCAGGATTGTTGCTCGAGTAACTTCCTCA
CCTCCCCTTGTCTGCTGGGTTTGCCTTTACCAGGCTGCCCCCTGGGCCAGGCTCAACTGA
TGCTTTTGGAAAATGGATTTTGAGCTGTAAAATATAGCTTTTCCAGATGTACACTCAAGC
TTCAGAAGAAAGAATTGGGTTAAAAGGAGCAACTAAGAGGGACCTCAGAGATCCTCTGGG
ATAATTGCTTTCAGTCTGGGTTTTCTGAAGCCTGAGTGTTCTGCAGAGGGGCCTGGGGTG
GGCTGGGAGGCAGCCCTGGGGAAGGGATGCTGAGGGTCTGGGCTCAGGGTCTCTAGGTGC
TCAGCCAGAAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved