Microcebus_murinus Locus Mono:212:SNORA51
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:212:SNORA51
Microcebus_murinus
Mono:212:SNORA51
GeneScaffold_3498
SNORA51
1001..1128
2128
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAGCTGTCAATATAAATAGCAGTATTCTGTTCCACTGCAATTCTG
AAAGTAGTTCACCAAGGGAAAAAAATAAAAAAAATCAAGTACAATGTGAAGACTCACTGA
AAATCCAGAAATACTATTCTCCCAAATTCTCTTACCCCTAATCATGATTTTATATTTTAA
ACTATTACTTGAATAAATTTTGCTATTAGAATTTTGTAATTTAAAAAAAAACTTTATTAT
TCTGATACCATCAGTAATTTACCAATTAATTTTCCTTTAAGTCAGTGAATTGTGAAAGGC
ATATTTAACAGAAAATGTAAAATATCACATGTTGTATTTTAAGAAGTTAGTTTTAGAGTT
AGAATTAATACTATCACTACTTCCTATGCTAGGTAATGTTATTTAATACTTAAAATATTA
GTTACATATAATACATAAATATTCATAAAATATACATTATAGGCCTTATAGTGCTTACCA
CAGGCTGTGTTCTTACACTGACTGTATAGAAAGAGGACCTAGAGTAAACCCTACCTGATA
TACACCCAAGGCCCTGTGTCTGGTCTGTATTGTGAACAGGGGGATATGGAGTGGAGAAAA
AGAGAGAGAGAGAGATGAGACAGAGATACATGAGAGATAGATGAGATGAGAGTGACAGTG
GGAGTGAAAGACACAGAGAGAGAAAGAGAGAGAATATGTGTAACTAACACCAATAAGTGA
ATACCATTCACTCCCGGTATCATGTACAATAAAAGCAATGTTTGGCTGGGTGCAGTGGCT
CACGCCTGTAACCCTAGCTCTCTGGGAGGCAGAGGCAGGGGGATTATTTGAGCCCAGGAG
TTCGAGACCAGCCTGAGCAAGAGTGAGACCCCATCTCTACTATAAATAGAAAGAAATTAA
TTGGCCAACTCATATATATAGAAAAAATTAGCCGGGCATGGTGGCGCATGCCTGTAGTCC
CAGCTACTTGGGAGGCTGAGGCAAGAGGATTGCTTGAGCCCAGGAGTTTGAGGTTGCTGT
GAGCTAGGCTGACACCATGGCACTCACTCCAGCCTGGGCAACAAAGTGAGACTCTGTCTT
AAAAAAAAAAAAGAAATGTTTACCAACCCATTTACAAGGGCATGTTTGCAATCCTTTCAC
TGTTGGCTCAGCCACTTTTTAATGAATCTCCACAATCACTGATACTATGGCAAATTCTAC
TCTTCTAACAGTGCCAAGAGACAATTATCATCATATTTTAATTCAAAAGACTCCATAAAA
AATGTTTTATAGGAAAAAATAACTTTCAACAAAAGCCACTTTTTCTGATCTTGTCAACTT
GTGGAATTAGCCTTTCTTAGAAACACAGCTATTTAGACACTACACCATTCCTTCAAGATG
ATGTAATCTTAAGGGACTTAGTAATCATAATATGTGAATTACTAACATAAAACAGTATTT
ACTGACATGACTAGACAAATAGAAAAGGCTTTCTCACCTATTCCTGGAGTCTTCATAGAA
ATCAGACATCCAGTATAAGAAAACAGGTGTTGAAAGTTCTGCTGGGTCACTTCTCATAGA
ATANNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved