Microcebus_murinus Locus Mono:77:SNORA48
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:77:SNORA48
Microcebus_murinus
Mono:77:SNORA48
scaffold_31569
SNORA48
1001..1134
2134
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATTTCAGTGTCTTTAAGGCA
GAATAGTATTCCATTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTA
TAGATATCTGTGCTTATATGTATATGTATATATACACATATACATATACATATGTATATA
CACACCACATTTTTTAAATCAATTCATTCTTTGATGACCATTTGTTTCCATATCTTGGCT
ATTGTGAATAATGCTGCAATGAACATGGAAGAGCAGATATCTCTTCAGCATACTGATTTC
AGTTTCTTTTGGTAAAATACTCAGTAGTGGGATTGCTGGATCATATGGTGTTTTATTTTT
AGTGATTTTGAGGAACTTCCAAACTGTTTTCTGAAATGACTATTCTAATTTATATATAGT
GCTCCCTTTTCTCCACATCTTTGCCAACACTTATCTTTCATCTTTTTGATAATAGCCAAT
CTAACAGGTATAAGGTGATGTATCATTATAGTTTTAATCAGCATTTCTCTGATAATTAGA
GATGTTGGGCATTTTTTCATATATCTCTTGCCCATTTGTATGTTTTCTTTTGAGAAATGT
CTATTCAAGTGCTTTGCCCATTTTTTAATAGTTATTTGTTTTCTTGTTATTGAGTAGTTT
GAGTTCCTTGTATTGCAGTTATCTTTCTAAAATGTATTGTGTGGTTCTCTACCCTCATAT
ACAAAGGATGGAACTTAATTCTTCTCTTAAAAATTCATTTATATCCCTGACCTGAGTAGA
GTGGCTTCTGGTTGGTGGTGCCACCTCATATCAGCCAGGGACAAAACAACCGCTTGTTTA
TCACAGCTTGGCTTTTGGTGTGTGCTTATGTCTGGTTCAAGCCTTTAACACATGGGAAAA
GGAAGAAAAAAAAATAAAAATCAAGCTTATTACCCTGAGTACTCATTATTATTCTATGAT
GTAATATAATTCTTTAAATATTTTTTTCTATTTTCTTCTTCAGTGTCAGCACAGTTCCCT
TTAATATCCCTCAGCCATGCTGATTAGAATGTGTTGCTTATAATCTCTTCTAGACTACAA
AACTAGGTAATCCATTTAATCAAAGCCTTATGATAAGACTTAAGAATCAGTCAGTGAGGC
CCTAGAGGAAATGTAAACTTTGTAGCTCTGATCGGAGTGACTTTAGCTTCTACTTCAGGT
TTCTTTGGCCATTGACGGATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved