Microcebus_murinus Locus Poly:4:SNORD113
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Poly:4:SNORD113
Microcebus_murinus
Poly:4:SNORD113
scaffold_4186
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1069, 4765..4835, 8754..8827, 9951..10021, 11337..11411, 14820..14891, 15802..15873, 16804..16872, 17693..17761, 18681..18756, 19679..19754, 20651..20722
21722
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGTTAGAAGTAATCCTACAG
AAAGATTGGTGTACACAAAGATAATGTCCTTGAACTTTTGCGGTTCATGCATTTTGATTG
TATTATAAAAAATTGAGGACAAAATTTCTACAATTGCATAAAGAACTATGAAGAGGGGGA
AGCATTGTCTAATTATAAAAATATGAGACAAAGCAAGAGACGCTATTGTTATAATTTGGA
AGTATTAACATCCATAAGTGAACAAAGGGAGCAGGGATGTTACCTCTTTGGAAAAGGGTC
ACCTAGGCAGTGACAAAGAATAGCCAGTGTTGTTCTGGAACACGGGCGAGTACCATGTTG
TCCTTATTTTTAAGGAGAAGCGAAAAGTAATATCAATTAGTAAATATTTAAACAATTTAG
TAAGTGGAAAAGCAATGATTACTGAAGAGAATTTATCAGTCTTTTATAGTCTGCCCTACT
TTGTGTTCCTCAAGGTGGAGGCTTCCTGCTGTCCCGAGGTCTGCGGTGGCCACACGCCCT
GTGGTTCGCCTCTGCACTGGGAGCGTGGAGACCAATGTGAGTCATAATCAAAGTCCTCAT
CTTAGTTTGGGGCGTTTCACGAGACTATTGAAAAGAGTGAATCGAAGCCCCGTGACAAAT
AAGGAATTGATGTGAAAAACACTCTATGGATTAACCGATACATGAAAAACTAAAGATAAT
AAGGGAGATAACATCGATGTGAGATGATTCTATATAAAGAATTAGAAATACCAAAGCTGT
GCCTGGGTTTTCTTGAATAACAAGGTTTAAAATTTAGTAGTGAATTAATGAATTAATCAA
AAGAGAATGTAGAAATGAATAGAGAAAGGGAATAGCAAGTTTGGATCGATGATGACTACT
GGTGGCGTATGAGTCGTAAACGATGACTACGTCGGTAATCTGAGGTCCATTGAAGAGGAT
CCTTGGTAGCCTCTCTCTGTCGAGTAGTGTCATAGACAGATTTCAGAAATGCAGAATGTA
CTTGTTTTTCTTTGTGGTTGCATATTTTCATTCTATTTTTATAATTGGATCAATGCAAGA
ATCAATAAATAAACATAAAGATAAATAAAGATATAATGGGTGAAGCAGAATCCAATTATA
AAAATATGTGGTGAGGCAAGAAATACCATTAATGTACATTGGAAACAGTGATGTCCAAAG
AGTAAATAAATGGCACAAGCCTGACACCTCTTTGGCTAATGATGGCTTAGACAGATTAAA
TTATAGATAATGTTTAATTTCTGGATCAGTGACAAGTTTAAAATGATTCATTTTCTAAAG
AGAAAATGGAATAAATATATACAAAGAATGATGGCCTAAATGATTAACGATAAGTGAAAA
GCAAGGATCAATAATGAGAATGTCTCAATTTTGTTTTCCTCTTCTCTGCTCTATACTCCT
CAGAATGGACGTGCTTGTTCTGATTTGAGGACTCTTCCATGGCCACATGCTGTTTGCACC
ATGCCTCAGAAGGAGGATGCAGACCCCTGTGAGTAATAGTCAACTGGTTTGTTTAGGAGT
AATTTATCATTTAAAAAACGATGAGGCCGGGCGCTGTGGCTCACGCCTGTAATCCTAGCA
CTCTGGGAGGCCAAGGCGTGAGGATCGTTCGAGGTCAGGAGTTTGAGACAGCCTGAGCAA
GAGCGAGACCCAGTCTCTCCTAAAAAAAATTGAAATAATTAGCTGGGAACTAATTTTATG
AAATTTAAAATTTATTAAAAAAATACAAAATAAAAAAAAAGTGTGAAATATAGTCAAAGA
TGGGTGTTATCCCAATGATAGATATGGGAGTGATATGAAGTATTATATTTATAATGCATA
TATAATAAACTGAAGATCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTCTGGAACTCTGAGGTCCAACACA
AAGAAAACAAGCCCTTTTCTCATGCACTTACATTCTGTTCTTATAATTGGGATCAATAAA
AGAATCAACAGTCAAATATATAAATAAAGATGACTCATTTGAGGCATTGTCCAGTTATAA
AAGCAGGTGGGGAGGCAAGAAATACTATTGCTGTATATTGAAAACTTACATCCACAGAGA
AATAAATGGTACATAACTGCTACCTCTTTGGCTAAGGATGCTGTGGACAGTATTAGGTAA
ATGTCAGTGTTCACATTCTGGGTCAATAGCAAGACCGATAATGTTAGTTTACATAGGAGA
AAATAAAATAAACATTACTCCAAGTTACTAATTATATATGACTGACTAAATAAGAGGGGG
AATTCAAGGACCGATGGAGATGATGTTGCAACCCTTTTAAATCTCTCTTCCGCTGTGTCA
TCCTCAGAATGGACACACTCGTGTTGAGGCAGGCATTCTTCCGTGGTCACAAGCTCCCTG
GTTGCATCCATGTCTTAGGAGCATAAGGAGCCATGTGAGTAGCAGTCAATGTTCTTGTAT
TACATGGAGCTTTTTTAGAAGAGGTATATACTGTGCGAAGTATTAAATATAATCAAAGAA
GGGATACCTGCCAACGTTAAATATCCGATCCATAAGCATTCTTTTGAGTAATGCATGTAT
GATGCACTTAGCTCAGTTAAGGGAAGAAATTTGGCCTCTGTGGAAATGATTATATAGATG
GATGTTAGGGGTGTTCAGGAATCTTACTGTTAGTAAGAATCACTCAATATGTGTGTAGAT
GACAACAGAGAACTAGGGCCAATCCTGGACCTGTGATGACGACTGGTGGCGTATGAGTTA
TTCACCATGAATACCGTGTCTGGAACTGAGGTCCAGCGAAGGCAGTAATCTAGTCCATTC
TCCCTTTTTAAAGGGATCCTACGGGCAGATGTCAGCTTATGCAAGGGTCTTGTTCTTGAT
CTGTGTGTTCATAAATTTAAAAATTATTCTTGTGAAAGAATCAAGGGCAGGAAAAATAAA
TGAGGAAAGATAAGAGAGGGCGAAGCATTGTTTTTTAATAAAATATGTATTAAGGAAGAT
GAATTGTAACATAAATTAGAATGGATGATATATAGACTGTGATAGTTAATAGTTATTACT
CTCAATCATTAAAGTCTATTTTATCAAGAAGACAATGAATATTAGATACATTAATAAAAG
CCAAAGTGATAATGTAGATGAATCCTATAATGTACGGGTCAGTGGAGAGAATGTCTCAAT
GTTTTTGTCCTCTCTCTGCTCTGTGCCTTCTAGAATGGATGCACCAGGCTGATGTAAGCA
TTCTGGCACGTTGGAGACTTTTCTCGTACTGCTGTTGTGTTTAGAAAGGGAACGACGTGA
GTAATAGCCAAATTCTTGTTTTCCTTTGCGTAGTCAACTTAAGGTGCTCATGATATTATT
AAAAATTTTAAATTAGTCAGAAGCTAACCATGGCCCAGTGATAAATATGATATGGGACAT
TATGCTTATTAATTGTTAATGTGCCACTTGGAGATTGATTAATGAGAAAGGCTTAGTCTA
ATGTGGAAAAGGGTTCTGTAGACAGATGTTGGAAATGTCAGGCATCGTGTTCGTAGGTTT
TTGTGAATCTGTTATTTTATTCTTATGAATTAATTAATGGCTTATTCAAAATAAATGCAG
AAATGAATGAGAATTAAGAGGCCAAACACGGGTTAGTGATGGGCTGGTGTCATGGGAGCC
ATATACGATGTGACCATATGTCACAAATGTCTTGGTCTAAGGCACCCTCTAGACGCAGGT
TAGGAATAGACAAGATCCCTTGTCTTGACCTTTGTGTTCATATATTTTCATTCTGTTAGA
ATTGGATCAATGAGAGAATCAATAAGTAAATAAATTAATGAAATATTATTCAATTAAAAA
TAAGTGTTGGGCCAAGAAACATTATTAATATATTACGAAACCACTGAATTCCGATTCAAA
ATAAATTTGTACCTGTCACCTCCTTGGCTAAGGATGAAATAGATAGTATAATTTACAGAT
AGTGTTCATGTTCTGGGTATGTGGCAATTTTCAATTTGTTCATTTTCTTAAGAGGAAAAA
AAAAATTACTTTAGATTAATGTTTGCCTAAATGACTGACTGAATGAAAGGTGAAAAGCAA
GGACAAGTGGAAAGAATGTCTTAGGTTTTTTTTTTTCTTTTTCTTTTTATCTGCCCTGTT
CTGTTTTCCTCACAATGGACCCATCTGGGCTGATTGGTTCTGAGCTCTGCGGTTGCATCT
GTACTGAGGACCTGGAGATCAATGTGAGTGATAGTCAAAACTTTTGTTATGCTTTGGGTG
CTTTGTTTAAGGATATTCACTATATTATTAAAAAATGTGAAATATAATCACATAAGGCCA
GTGGTTACCAGTGACAAAAATGAAATTTATATAAAGTATTATGTTGATTAATTCATGTGT
AAAACCCAGTATAGTTAATGAAGGAGCTATATTGATGTGAGATGATTCTATATACAGATT
AGGAATGTCAAGCCTCTTCTTGGGCTTTGTGGACCCTGGGGTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATGGATGAAATGCATTATGT
CTGGACTAAGGATGGCACAGACTGTGGTAATAGTCAGTAATCACTCTCAGTTATAAGTTT
GTAGTTTACTAGGAGAAAAAAATAAATATTACCATTCAATAATGGTAGAAGACTATGTTC
ATGAATGGTAGAAAATGTGGATCAATGGAAAGAAGGTCTCAATGTTTTTATCGTCTTCTG
TGCTTTCTACTCTTCAGAATGGATGCACCCAGCTGGCTGAAAGTGTTCCGCTCTGGTCAA
GATTATTATGTTGCCTCTGCGTTGGGAAAAAGACCACGGTGAACTCTACGCAAACTTCTT
ATCTTGGCGTGGGTGATTTGCTTGAGGGCATTCATGGCATTATTATAAAAAGTATTAAAT
TATTCAGGAAGATAGAAGTAAGTTCAAGAGATACATTGTACAACATGGTGACTATATTTA
ACAACAATATATTGTATTCTCAAAAAAGGCTGAGAAGGGGATGTTAAGTGTTTTTACCAT
AAAAATAGCTATGTGAAGTAATTCCTATGTTAATGAGATAGATTTAGTTATTCCACTATA
TATATATATGCTTCAGGACATCATGTTGCACATGAAAAATGCATACAATTTAAATAAAAA
TTTAAACCTGGCCGGGCGCGGTGGCTCACGCCTGTCGTCCTAGCTTTCTGGGAGGCCGAG
GCGGGCGGATAGCTGCTGCTTTAGGGGTTCGACACCAGTCTGAGCACAGCCTGGGCACAG
TGAGACCCCGTCTCTAAAAAAAAAAATTTAAACATATTGAATTAATAAAAAATTAACCTT
GGCTCGTTGACAAGTATGATATGAAACATCATGTTGTTTAATTTATCATGTGCAACACTG
AGGTCAATTAATGAAAGATAGTCTACATTAAAAATAATTCTATAGATAGTTGTTATAGAT
ATTTAAGGACCTTGGGCTTTTTTGAACCATGTATCTATTTTTATTTAATATTAATAAAAT
AATCCTTTAAATGATAAAAATGTAGGAACAAATGAAGAAAGTGAGACTCAGTCATGGACC
AGTGATGACAACTGGTGGCGTTTGAGTCATGTACGATGAATAATTCGTGTTTGAAATTGA
GGGTCCAACACAAAATCTAATTAGTTGATTCCTTTTGTTGGAATTGTCTCTATGGAGAAA
TGTAAGGAATATATAAAGACAATGCCCTCATATTGATTCAGTTCATTTAGCTTTATTATT
GTCAATAGCTCAGTGACAGATTCACTAAACTAATATAAATTAACATATAAAGAAGAGCAT
CGAGCATTGTCTATGCACGTTTATGTGGAGATAAGAAATATTAATAAAATTTGAAAACAC
TGATAGCCATTTAGAAACAAATGCATATTTATTTACCACTTTGAGCAATTTATCTTACCA
CTTGGGTAAGAATCATATAAGCAAGAGTCTAATTTTATTATTCTAGGTTAGACTCAAGAT
GGAAGTGTTCCTTGTGTTATGATTAAAAAATATGTGTATACACTCACTCATAATGAACAA
GATAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAGGAGTTTG
AGGTTGCTGTGAGCTAGGCTGACGCCATGGCACTCACTCTAGCCTGGACAACAAAAGCGA
GACTCTGTCTCAAAAAAAAAAAAAAAAAGTATGAAATATAACTAAAGAATGCAAAGGTAG
CCCAGAGATATTGATGGGATATAGGAAATGATACAGCAATGGATGCATATATGAAAAACT
GAGGATAATTAATAAAATGCTATATTGGTGTGAGAATAATTCTATACATAGATTAAGGAT
AGAAAGGCTCTTCTTGAGTTTTAGTGAATAGTAGCATTTTAAAATTACCATTTTGTGGTT
TAATGAATGAATAGACAGACGTAGGTGAGAGTAAAGTAAGAGGGCCAAGGCTGGACCGAA
TGATGACGACTTGTGGCGTATGAGTCACGGACGATGAATACGTGTGGCACTCTGAGGTCC
AGCGTGGAAGGTCCTCAGTCCGTCCCCTCTGACACGATCCTGTAGCTGGGATCTTGGCTT
TGTTCTTTCGCTCGAGGAAGTCTCAATGTTTTTATCATTTCCTCTGATTTGTATTTCTCA
GAATGGACCCACGCAAACCGATTTAGGAATTCTTCCTTGGCCAGAAGCTTGTCGGTCGCG
CCTCTGTGATAGGAGCCCAGAGAAGAGTGTGAGTGATGAGGACGTTCTTGTCTCGTTTTG
GGTGGTTCGTTTAAGGGTAGTCTCTGTATTGTTAAAAAGCGTGAAATAATAACCAAAGGC
TACGCGGACTGTAGCCTAGTAACGAACACGGAGTTAATATGAAGTAGTGCATGTTTCATG
CATATGTGAAATGCAGGGATAGTTAATGAAAGAGATATGTTGAAGTGAGAATGATTCTAG
GTACATATTAGTGATATCTAGTCTCTGAGATTTTTGTGAATCAAAGAGCTTTTAAAGTAG
AATTACTGAATTGATCAATAAATAATTCAGAAGTGAATGAAAGAAAAGTGGGCCTTTCCT
GGACTGATGATGACAGCGGCTGGGGTATGAATCTTGGATGATGAATAATCTGGAACTCTG
AAGTCCAATGCAAAAGGAAACTGGCCTTTCTTTTCATGCACTTCATTCTAGTACTATAAT
TGGATCAATGAGAGAATTGATAGACAAGTATATAGATAAATCGAGATAAAATAGGTGAAA
CTTTCTCCAAATTTAGAAATATGTGCCAAGGCAAGAAATACAGTTAATGTGTGTTGAAAA
CATGAAATCAAATGAGAAAATGATGAAATGGTATCATCCAAATGAATGATTTCATGATCC
TAAATGAGCACCTACATTATAGATGTAAAACAAGGAACAGTGGACATTGGGTCTCTCTTT
TTTTTTTTTTTAAATCAACAGCCCTACTTTCTTCACCCCAGAATGGACTCACTCCAGTAG
ATTCACGCACTGGGAGCCTGCAGACCCTTGTGAGTAGTGTTTTTGTCTTGGCCTGAGTGG
TTTGCTTAAGGGTATTCACTGGAGTATTAAAAATTTTGTAATATAATAAAAGAAGGCCAA
TCGCAGCCCATTGACAAACATGGGATCGACATGGAGTATTCTATTGATTACTTCATTTAA
GAAAAATCAGGATATTCAGTAAAAGAGATGTAGTGATCTGAAAATGATTCTATAGACATA
TGAGTGATATCGAGGCCTTTTTCAGTTTTGTGCATCATAGCACTTTAAACTTATTATTAG
TGAATTCCTGAATTAATCAACAGTGTAGAGATAAGTGAAGAACAGGTGGGCCATTCCTGG
ACCAATGATGACGACTGGTGGAGTTTGAGTCGAACATGATGAACACTGTGGGTCTTGAAC
TCTGAGGTCCAACACAAAAGGAATCGTGTCCACCCTGTTCTGTTTGAAGGGATACTATAG
ACAGATGTCAGAAGTATGCAAAATCTAGCTTTTTGCCTTCGTTTTGTGCTATGGACAGAT
CATACATTCTGTGTCCATGGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCTTGGGAGCCTGCAGACAGCGTGAGTCTGTCTATTCCTCTGTTCAACTGTCAACTG
TCCAATTGATGTCAAGGATATACAAGGGTCTTGTTTTTGGCTTTTGTGTTCATGAATTCT
TAAAGAATAACATTATTAAGTATAAGTGGTAGGATAAATACTAAAAAAAATATATATAAT
AAACAAATATCAAGGCAGTGAAGCATGCTCATTGTGAAAATAGATAGTAAGGAAAACTGA
TATTGATATACATTGTAGTAATGGAGCAAGTGTATTTTGTCTTAGACTAAAGTTGATAAA
ACGTGATAGGAAACAGTTTTTGATGAGTTGCATATTTGGTATTTGATTCATTAAGAGAAA
AATAAATAAATATTACCATAAATTTAATTTAACCCAAATGACTGTATAAAGGGATGGAGG
AATCTATGGATCAGTGGAGAGAATGTCTCAATTTTTTCATCGTTTGCTGTGCCATGTACT
CCTCAGATGGACAGCTGATTTAGTCTAGGATCACGAGTCCACATCTATGTGTCAGGGGCA
TGGAGACCAGTGTGAGCAACAAAGCTGTCTTGGTTTGAGTGATTCAAAGAAGGTCAACCA
TATCAGATAGCTGTGAGGTATTATGTTGATTGATACATAACTGGAACACTGAGTTCAGTT
AAAGAAAGGGATTTAGGCTCTTTGTAAATAGTAGTATGGATGAATGTTAAGGATATTGAA
GATCTTATTCTTGTTTTTTGTGGATTACATAAATTTTTATTAATGAAGTAGTCAATAAGT
AAGTATAGATAAGAAGGCGAATCTTGGACCACCAATGTTCAGAAGTTCCCCCACCTTTCT
GGCACCAGGGACCAGTCTCATGGAAGACAATTTTTCCATGGTTAGGGGGACTGCAGGGAG
GGGGAGGCAAGCAGAGGTCTGCAGGCCCATCTGCAGCCCAGGGGTTGGGGACCACAGGAT
GTCTTCGTGTATGATTGTTGTTTATGATGAATACTAGGTGCCTGAAACTTTGAGGCCCAA
CACAAATAGGATCTAGCCCATTGCCATGTTTAAAGTGATACAGTAGACAGATATCAGGAA
TATGCAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATAACAAATGGACCCAGTATATCAC
TAAAGGTGATATAGGCAATAATAATAATAATAATTACTAATAAGTAATATTTATTGCCCT
AAGCCAGTGATAAGTTTGAAGTTTAAGAGAAGAAAATAAATATTACCATAAATTAATAAA
TACCTAAATGAAAAACAGAAATTATAGATCAATGAACAAAATATCTCAATCTTTTTATCA
TCTCTGCTTGCTACTCTTCAAAACAGAATCACTGAGCTAATCTAAACATCATTGCCATGA
TCACCTTTCTTATGCTACTGCTTTGTTCAAAAAGAGCCCAGTGTCAGTAGACTCAATGCC
CCTGTCTTGGTTCCAGTCATTCAGTTGAGGGTATTCATGGTAGTATTAAACAATACTAAT
CAAATGTGATTTTATATTATATAAGAAGAATAAGCATATGTTTATGCTTAATTTTACTTA
TATTTAATTTTCCTATGTGCATATTAAACTGACATTGGAATAAAATACATTTAAGTCCAA
AAAAAAAAATCAACCGAATAGTTATTTATGGCCCAATAATAAGGATGATGTGAAATAATT
ACGTTGATCAATCAATACTGTGTGCAGCATTGGCAATGCTTAATGAAAAAGATATAATGT
ACACAGGAAATGATTGCGTTGGTAGATATTAGCAATACTCAGGCATTTTATTCCTGCGTT
TTTCTGACTCATGTTTACTTTATTATTTTCACTGCAGTAATGATCCAGCCTCTGCAAATG
TGAAAGTGAATGAAGAAAAGTTGGCCGGTGATTACACAGGGACAATGATTCCGACTGGTG
GCATATGAGTCACAGGCTATGAGTAATACATGTGGGGGTCGGAGCAGCAGCACATCATAA
TTAGTCTAGTCCTTCTGTTCGCAAGAATCCTGCAGGCAGATGTTTGGAATCCACAGAGAT
CATGTTCCTGTTTGGGATTCATAGATTTATTAGTATTAATGGATCAATGACAAAACCATT
AAAAAATATAAGTAGATAGATAAAAAAAAGGGTGAAGCATTGTCCAACTGTGAACATATA
TAGTGAGGCAAGAAATATTGTTAATACAAATAGAGAAGACCGATGTCCATTAAAAAAAAA
AGCAGTGAGTCAAAGATGTTACCTCTCTGGCTTAGGATCCTATAGACACTGACAGTAAGA
ATTTGTTTTATTGTTTTGAATCGGTTCCCAGTTAGAGGTTGTCCCTTTTGTTAAGAGAGA
AAATATACACCTTATGAAAGACTATAAAGCCCCTGAATGATTAAGTAAATGCAATATAGG
AAGCAAGAACCCTACAGGATGAGCTTTCCAGTTTTCCCCTCACCTGGTCTGCTCTGTTCT
CTGCAGGAGGGATGCACCCGCTGATGGACGCATTCCTGCATGGCCACTTGCCCTGTGTCG
CACCTGCTTGTTAGCAGCATAGAGACCCATGTGAGTAGTACTTAAAAATTCTTGACTTGG
TCTGGACTATTATTTAAAAATATTCACTATATTAATAAAAAATATATAATACAATCAAAG
ATGGCCAACGGTATTCTAGCACTCTCTATGGGAGTGATAGGAAGCCATTACACATACGAA
AAACTGAGGATAATTAATGAAACAGATATATCAACACTAGAATGATTCGATGCAGAGATC
AGGAACATCAAGGCTCTGCTTTGGATTTTGTGGACCGTAGGTTTCCAAATTGCTATTGGT
AGATTAATGAACCACTCACAAACAGCACAAAAGCAAAGGGAGCCACAAGAGGGGCAGTCC
TGGATCGATGATGACTACTGGTGGCGTATGAGGGTGACACGATGAATACGTCTCTGGAAC
GCTGAGGTCCATCACAGAAGGAACCTGGCCCCTCTCTGTTCATGAGATCCCGTAGCCCAG
CGTCAGGAAATAGAATGCACTTGTTTGTACTTGGTGCTCATGAATTTTCATTCTGTTTTT
ATAATTGGACTAATGTAAGAATCAGTAAAGAAATATAAAAATAAATAAAAATATAATGAG
TGGAGCATCGTCCAATTATAAAACAATGTGATGAGGCGAGACATACTATTAATATGTACT
GACAATAGTGAAACCCAAAGAGAGATAAATGGAACACGCCTGTCACATCTTTGGTCAGTG
ATGGCACAGACAGTGTAATTATAGATGACGCTCATGTTGTAGGTCAGTGGCAAATTCAAT
TGTTCATTTACTTAAAGGACAATGAAAGAAATATACCATACACTAAATAATGATCGCCTA
GATGACTGAAGAAACGTGAGAAGCAAGGCTCGATGGTGACAATATCTCAAATTTGTTATT
TTCTTTGCTCTATATTCCCCAGAATGGACGTACTTGTTCTGACTCGAGGATTCCTCCCCT
GTCCCATGCTCCGTGGGCACCGTGCGTTGGCAGGCAGATGCAGACTCATGTGAGTAATAG
TCCAAGTCCTTACCTTGGTTTGGATGGTCCATTTAAGAGCATTCAATCTATTATTGTAAA
GTATGTATATAGTCAAAGACAGGCAATATTATCCAAGTGATAGATACGGTAGTGATTATG
AATATTATATCGATAATGCATTTATGAAAAACAGGAATATTAATGAAACATATATATCCA
TGTTAGAATGATTCTATGTAGAGATTAAGTTCATCAAGGCTCTTCCTAGAGTTTCTTGAA
TGTTAGGCTTTAAAGTTATCGTTCGTGAATTAATGACTTAACAGATAACGTAGAAATGAA
CAGAGAAGAGAAGGACCAGTCCTGGATCGATGATGACTACTGGTGGCGTATGAGGGTGAT
ACGGTGAATACGTCTCTGGAACGCTGAGGTCCATCGCAGAAGATAACTGGTCCATTCCCT
CTGTTTCCAGTGGTCCTATAGACCCATGTCAGGGATGTAGGATTAAATTGTTTTTGGTGT
TGGTGTTCATGCAATTTGATTCTATTTTTATAATTGGAACAATGCAAAAATCCAAAGATA
TATAAATAAAGATGTATAAATGAATAAAGACAAAATGGGTGAGCATTGTACAATTATAAA
AATATGTAGGGAGCCAAGAAGTACTATCATCATATATTAAAAACAGTGAAGTCCAAAGAG
GTATTTTACATACCTATTACCTCTTTGTCTTATGATTATAGACGGTATAAATTACGGACC
ATGTTCAAATTCTTAGTCATTTGCAAGATCAGGATCCTAAGAAAGTGAAATAAATCTCAG
TCCACATAATGATTGTTTAAAGGACTGACTGCAGGAAAGGGAACGGCCAGGCCCGTTAGT
GCAAATGTCTCAATGTCGTTGTCTGCTCTGCTCTGTACTCCTCAGAACTGGTGACTTGCG
CTGATTTGTGGATTCCTTCAGGATCAGATGCTCGGCTTTTGCCGTGGTTGGGAGCGTGCA
GACCACTGTGAGTGATAGTCCAAGTTCTATTCTTGGGGTGGGCGTTTTGTTTAAGATATT
TAATGTATTATTTAAAAAGTATACAATATAAATAAAAGATGGCCAGGTGTATCTCAGGCA
TAGATACAGAGCGATAGGAAGTACTATATTGATAATATTGATTATCAATCAATATTAATA
CATATCGATAATATGTAAAACCCGAGGATAACTAATGAAAGAGATACAACAATATTAGAG
CAATTCTTTATGCAGATTAGGAATATCAGTGCCATTCTTGAGTTTTTATGAATCAAAGGT
TTTAGAGTTATTATTGGTGAACTCATAAATTATTTAATAGACACGGAGAGAATAGGGTGA
CTCCCAGGCCGATGATGACTACTGGTGGCGTATGAGTCGAATACGATGACTACGTCTGTA
ATCTGAGGCCAACAGAAGAAATCTGGCCTAGTCTCCTTGTTTCAAATGATGTTATAGGAA
GATTTCAGAAGCACAGAATGTGTTTGTTTTTTTTTTTCTTTCTGTATACATATTATTTTC
ATTCTATTTTTATAATTGGATCAATATGAGAATCTGTAAACAAATATGTAAATAAATGAA
GATAAAATGGTTGAAGTATTGTCCAATTATAAAAATACATGGTAAGGCAGGATATACTAT
TAATATATATTAAAAGCAGTCAAGTCCAAAGAGAAATAAATGGTACATATTTGTCATCTA
TTTGCCCAATGATGGTAAAGACATTATATCTTATAGACAATGTCCAAGTTCTGGGTGTGG
CAAGGTGAAAAGAAAGGATCAGTAACAGGAATGTCTCAATTTTGTTATCATCTTCTCTGC
TCTATACTCCCCAGAATGGACATATTTGTGCTGATTTAAGGATTTCTGCATCATCATGTG
CGGTGCAGCTTAGGAAGGAGCATGTAGACCTATGTGAGTAATTGTCAAAGTCCTTATCTT
GCTTTGGGTGTTTTGTTTGAGAGGATTCAATGTCTTATACAAGGTCAAGATGGCCTACTG
GATCCTATCTCAATAACAATAGTGTGAAGTATCGTATTAATAATGCATATATGAAAAGCT
AAGGATAATTAATGAAACATATATATATGTTAAAATGATTTTGTTTAGAGATTAAGAATA
TTAAGTCTCTTTATAGGATTTTGTAAATCACAGAATTTAAAGTTATTAGTAGTAAATTAA
TAAATTAATCAGTAGACGAGGTAGCATTGAATGGAAAATAGGAGGACCCATCCCGGATCG
ATGATGACTACTGGTGGCGTATGAGTTTTGTTCGATGAATACGTCTGTACTCTGAGGTCC
GTCACAGGAGTAGTCTGGCCCAGTGCATCTATTCTAGATGATTCTAGAGACAGATTTCGG
AAATATCGAATGTATTTTTTGACCTTTGTGTTTGTGTATTTTTATCCTATTTTTATAATT
GGCCAATGTGTGTGAGTGGATAAACATACATAAATAAATGAAGCTGGAAAAGTTTGAGCA
TTGTCCAAGTATAAAAATGTGTAGTGAGGTACGAAACAGTCTTAATATGCATTGAAACAA
GGAAGTCCACAGAGAGATGCATGGTAGGCGCCTGTGATTTCTGTGGCTAATGATGTTGTA
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCCGGAATCAGTACT
GAGAGTGTGTCAACTTTATCATCTTCTACGCTCTATACTCCTCAAAGGGGATGACCCGTG
CTGCAGTGATGATTCCCCACGACCACGTGCTCTGTGCTGAGGAAGGAGCCTGCAGACAGC
TGTGAGCAATAGTCAAAGTCCTTATCTGGGTGTGGGTGGTTTGTTTAAGACGATTCGATG
TCTTATGAGAATCAGACATACAGAATCAGACTGTATTCGGATACAGTCGGCCATCTTACA
ATCAAAGATGGCCGACTGTATCCGAATAATAAATATGGGAGTGATGTGTGGAGTATTATA
TTGAAAATGCATACCTGCAAAACTGAGGATAATAAATGAAATAAACATATCAATATCAGA
ATGATTCTGTATACAAATTAAGGATATTAAGGCTGTCCTTGCAGTTTAATGAGCAGTAGG
ACTTAAAATTATTAATTACTGCATTAATGAATAAATCAACAGACGAGGTAGAAAAGAACT
CCAAGGAAGGAGGGCCAGTTCTGGACCGAATGATGACAACCACTGGTGGCATATGAGTCA
TGGACGATGAGTACATCTCTGGAACTCTGAGGTCCGTCAGGGAGGAAATCTGGCCCATCC
ACACATTTGAGAGTATTCTACAGACAGATGTCAGGAATACAGAGTGTATTTATTTTTGGC
ATCCATATTTACATATTTCTATTCCATTTTTATAATCGGTCAATGTGAGAAGTAATAAGC
AAATATATAAATAAATAAAAATGGATAGCAGTAAACACTGTCCAATTATAAAAATATGTA
ATGACAGAAGCAGCATTCTTAATATATTTTTAAGCAGTGAAGTCCACAGGGGAGCGAATG
TTTCATGCCTGTGACTTCTTTGGCTAACGATGGTATAGACGGTGTAAAGTATAGACAGTG
TTCAGTTTCTGGGGCAGTGGCGAGCTCAAAATCTGTGCTCCCAATAATGATTGTGTAAAT
GACTAGCGAATGACAGGTCAAAAGCCGGGATCAGTACTGGGAGTGTGTCAACTTTATCAT
CTTCTCCGCTCTATACTCCTCAAAGGGGATGACCCGTGCTGCAGTGAGGATTCCCCACGA
CCACGTGCTCTGTGCTGAGGAAGGAGCCTGCAGACAGCTGTGAGCAATAGTCAAAGTCCT
TATCTGGGTGTGGGTGGTTTGTTTAAGACGATTCGATGTCTTATGAGAATCAGACATACA
GAATCAGACTGTATTCGTATACAGTCGGCCATCTTACAATCAAAGATGGCCGACTGTATC
CGAATAATAAATATGGGAGTGATGTGTGGAGTATTATATTGAAAATGCATACCTGCAAAA
CTGAGGATAATAAATGAAATAAACATATCAATATCAGAATGATTCTGTATACAAATTAAG
GATATTAAGGCTGTCCTTGCAGTTTAATGAGCAGTAGGACTTAAAATTATTAATTACTGC
ATTAATGAATAAATCAACAGACGAGGTAGAAAAGAACTCCAAGGAAGGAGGGCCAGTTCT
GGACCGAATGATGACAACCACTGGTGGCATATGAGTCATGGACGATGAGTACATCTCTGG
AACTCTGAGGTCCGTCAGGGAGGAAATCTGGCCCATCCACACATTTGAGAGTATTCTACA
GACAGATGTCAGGAATACAGAGTGTATTTATTTTTGGCATCCATATTTACATATTTCTAT
TCCATTTTTATAATCGGTCAATGTGAGAAGTAATAAGCAAATATATAAATAAATAAAAAA
TGAATAGTGGTAAACACTGTCCAATTATAAAACTATGTGATGACAGAAGAAACATTCTTA
ATATATTTTTAAGCAGTGAAGTCCACAGGGGAGCGAATGTTTCATGCCTGTGACTTCTTT
GGCTAACGATGGTATAGACAGTGTAAAGTACAGACAATGTTCAGTTTCTGGGGCAGTGGC
GAACTCAAAATTTTTCATTTTCTTTAGAGAAAATGAATTAAGTGTGCCCCCAATAATGAT
TGCATAAATGGCTAGCTAATGACAGGCGAAAATCCAGGATCAATACTGGGAGTGTCTCAA
TCTTATCATCTTCTCTGCTCTATACTCCTCAGAGTGGAAGACCTGTGCCATGCCCTGTTT
GGACCATGCTTAGGAAGGAGCATGCAGATCACTGTGAGTTGATAGTTAACGTTCTTGACT
TGGCTCAGGTGCTTTCTTTAAGAGGACTCAATGTATTATCGAGAAGTGTGTAATATATTC
AAAGATAAAGCCAACTGTATCCCGGTGATACTTATGGCAGTGAGATGAAGTATTTGTTGG
TGTAATGCACACATGAAAATCCGAGAACAGCTACTGAAACAGATACGTTAATGTTAGAAT
GATCATGCAGAGTAGAAATGTCAAGTCTGTTCTCGAGCTTTGTGAAATGTAGCAGTTTAA
AATTATTATTGCTGAATTAATGAAATAATTTACAGACAGTGTAGAAACGGTAGAGAAATA
GAGGGTCGATCTGGACTGATGATGACTACTGGCGGAGTATGAGTTGTACACGATGACAAC
GGGTCTGGAACTCTGAAGTCCTTGGTGAAAATCGGTTCCCTCTATTTTGAATAATCCTCT
GTATTCTATAAGAATATAGAATACATTTGTTTTTGGTTTTTTTTGTTTACGTATATTTAT
TTCATTTAATAAGTTGATCAATTAGAAAATCCATAAAATAGATGCATACATAAANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved