Microcebus_murinus Locus Mono:45:SNORA19
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:45:SNORA19
Microcebus_murinus
Mono:45:SNORA19
scaffold_50071
SNORA19
1001..1132
1867
ACTGTGGGACAACCAGAAAAACTGTACTGTACTTAGGAAGGGAAACTACAAGGAGAAAG
AAAGAAAACAAGGAACGGAAGAAATATTTGAAGCAATAATGACCAAGAGCTTCCCCAAAT
TAATGTCAGACACAAAACCACAGATCTAGGAAGGTCAGAGAACAAGCCAGATAAATGCCA
AAACAAAAAACAAAAAACAACAGCAAAAGCTATACCTGAGCATATTATATTAAAAAATAT
ATTAAAAAAAAAAAAGAGAAATGTGCACTCTCCTTCACTTTTGAAGGACAGTTCTTCAGG
GTGCAGAATTCTAGATTGGTGGTTTTTGTCTTTCAACACTAAATATTTCATTTAACTCTC
TTGTTTGTAGCGTTTATTGGAAGTGGGATGCAATTCTTATCTTTGCTCTTCTGTAGGTAA
GGTGATTTTTTTTCCTCTGGCTTCATTCAATAATTTTTCTTTATCTTTGAGTTTATTAAG
TTTGAATATGATATGCTCAGGTATAGTTTTTGCTGTTGTTGTTTTTTCTTTTGGTATTTA
TCTGGCTTGTTCTCTGATCTTCCTAGATCTGTGGTTTTGTGTCTGACATTAATTTGGGGA
AGTTCTTGCTCTGTTGTCCAGGCTGGTGGGATCATAGCTCACTTCAACCTCAAACTCCTG
GGCTCAAGTGATCCTCCCACCTCTGCCTCCCAAAATGCTGAGATTCAGGCATGAGCCATT
GTGCCCAGCCTCAAGAGTGCACATTCCATTGACCTGCTTTCATTTGTATATGTGAGCAGT
ACTTTTTCTGATGTGTTATACAAATAGTTCAAGGTAAGTTAGCAGTATAGCTATAAAGAG
TAATGTTGCCAGTCTCCTTCGTATAAAAGAAATTTATAAAACATGCTTAAATGTATTAGG
TAAGTAGCAGATCTTTTTCTACAAATATGTGATATTTAGGTTTTTTATTTTATGAAATTA
AGATTTGAAAAGATTATACATTTGAGGAATAGTATAATATGATAGTTAAAAGCATAGGAT
TTGGGGCCGGGCACGGTGGCTCACGCCTGTAATCCTAGCACTCTGGGAGGCCGAGGCGGG
TGGATTGCTCAAGGTCTGGAGTTCGAAACCAGCCTGAGCAAGAGCGAGACCTCGTCTCTA
CTATAAACAGAAAGAAATTAATTGGCCAACTAATATATATAGAAAAAATTAGCCGGGCAT
GGTGGCACATGCCTGTAGTCCCTGCTACTCGGGAGGCTGAAGCAGCAGGATTGCTCGAGC
CCAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGACGCCATGGCACTCATTCTAGCCTGGGT
AACAAAGTGAGACTCTGCCTCAAAAAAGCATAGGATTTGGAGCTGATAGCCTGGGATTGG
AAGCTGATAGCCTGGGATTGGAATTCCAGCTTTAGCAATGTACTATTAATGTAAATTCTC
TGCACTTCAATTTTTTTTCTTTGAATGAATGGCTATAATTTCTACTTTCCATGGCTGTTG
TGAGATTACATATAAAAAGTGCTGAATAAATGGTGGCTAATTCCTCTCGACCTAGAAATG
GCTTAAAAAAAAAGTGGCTGTTATGACTAGCCCTTTGTTTTCTATGTAAAAAAAAAAGTA
AAGGACAAATACTTTTTGAAACAAAAATCGAAGAAATTTGTTTCCAGTAATCTGTGTAGC
AAGAAATGTTAACAGAGGCCGGGCGCTGTGCTCACGCCTGTAATCCTAGCTCTTGGGAGG
CCGAGGCGGGCGGATTGCTCAAGGTCAGGAGTTCAAAACCAGCCTGAGCAAGAGCAAGAC
CCTGTCTCTACTATAAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved