Microcebus_murinus Locus Mono:50:SNORD77
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:50:SNORD77
Microcebus_murinus
Mono:50:SNORD77
scaffold_6468
SNORD77
1001..1061
2061
CTAAAAACATCAACATATATTGTGTAACCACTTAAAATAACAATTTGGAGGTTGCAAAA
ATCAAAATGCACTCCAACAAAAAGTTAACCCTATAGCCAGGTGCGTTGGTTCGCTGTAAT
TCCAGCTACTTAAGGAGGCTGAGGTGGGAAGATTGCTTGAGACCAGGAGTTCAAGATCAG
CCTGGGCAACATAGTGAAACCACATAAAAAAAAAGTTATCCATACAGATTTCATGTAATC
ATGTTCATTAGTTTTTACTGACATGAGTAAAATCTAGCACTAAAATCTATTCACTATTAT
AAAATGTTGAATCAAAACCAGTACCTCAGAAAAATTCTCTTTTAAATGAGAATATGCTTA
AAAATGGTTATATTTCTCACCTTGAAGAATGAGCCTCAAGAAACTGGCGGAAATGTTCAA
ACTCCAGTTTGTTGTTAAGCAGATCATTAAAAGTAAAATGCTTGTATTCTTCACGAACAT
TACTCCAATATTGTTTTTGTTTAGAGACGTTAGAGAGTGACAAAACACTAGTTCCAATTT
CACCAGTGGTGTCCTAGTAAAAGGATACTTTTTATAAAAATCTCTTAAATACAGCAAAGT
CTTTACAATTTTAAATAGAGAAACTAAAAGAAAAATGATCAGGCCAAGGACATTTAACAA
TTCAATGGTAGAACTGGATAAGGACTCTAGGTGTCTCAGATTCTAACTTATACCAAAGTC
TGTTCTGTTTGTTTCCATTCCATTCCATTTTCAAGAACATTTAGTAAACATTTACTATCC
ATAAAGCACTTCTTTGTAAAATATTAATTTTATTATTTTTCTTAATATTTTTCTTAATAT
TTCTATTATTTTTCTTAATTGTCTTTTGTAATAAAAAAAGAAGGAAATAAAAATCATACA
TAATACTATCATTCAGAGATAATCATTAACATTTTTGTATATAGCTTTTCAGTCCTTTCT
GTACTTTTCCAAGTAGTTTATTAAAAATAGGATGGTTGAACATAGGATGGTTGAATAGTT
CAGCAGATTGAATCATGAAGAAATTCCCCATGTCTGATATAATTTTTAAAAAATGAAGAC
AGGATTATGCACCCATGTATATATGGTTTGGTAACCTGTTTCTTTTTCTTAACAATATAT
CATGAACATAAAACATTCTTCTATAACAATTTTAAAAAGTTATAGAGCAATACAAGATAC
TTATCTAATAATATATTCTTCAAATGTAATGTCTTTCATATAAACATTAATTTTTAAGTA
ATTTTAAGACCTCTGATGTTTTGTGAATAATGTACAAACCCTAAAGAGCAAAGAGGTAGA
GAGGCTCATTCTTTGAAAGGCCCTTCCTTATATAATTCATTCATCTCCCCATTCGTTTTT
ATTTTGACAGTTTATCTTACGGTTAGCTGCCAATAACCTGCCGATATTTTAAAAACTAAT
TTTCCTTATGTAGAAGGACTATGGAGAGTGTTATCAATTTTAGTTCATAAAGTTTAAAAT
ACAAACTTATCTCGTACTACCTCTATAGATTTATATGTATCTTTTCCAGGATATTAATTA
GTAATGTCTCTAAAATAGAGAACTTCTGTGTTAATAAGGCAACTATCATAAAAGTTACAT
TTTAAAAAATATTATTTTTGTAAAACTTTATTATAAAAGAATAACAATTTCAGAGAGGTA
CAAAGAAGAAATTTAAAAAAGTCAACTGAAACCTCACCATTCAGAGCTAACTATCTTTAA
CATTTTGGTGAGTATCTTTCCAGATTCTCTCTTCTTGCATATATGGACACATGTAGAAAT
ACATATTTAATTTTACCCGAATAGGATCATATCACACCAGTGTTTTTGTTCCATACATCT
TTATATAATAATATGTCATAAACATTTCCAGGTCAATTAACTGTCATTTTTATGTAGATA
TATATATTCAAATTTACGGCTTTTTGGATCCGTCATGGTTTACTTAGACAATTCAAAAGA
TGCAAATTTATAAATCAAAGTAACACTTCAATGTTCTAGTCGATTTTATGATCTTTTTAA
TAACTTTCCCAACTCCTTTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved