Microcebus_murinus Locus Mono:176:SNORD72
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:176:SNORD72
Microcebus_murinus
Mono:176:SNORD72
GeneScaffold_4021
SNORD72
1001..1079
2079
TTGGGAATATTTTTTGACATCTGTTCTTTATTAAACAGCCATATGAGATATAATTTATG
TACCATAACATTCACCCATTTAAAGTATACAGTTCAGGCCGAGCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTAGTCCCAGCTACTTGGGAGGC
TGAGGCAGGAGGATCGCTTGAGCCCAGGAGTTTGAGGTTGCTGTGAGCTAGGCTGACACT
ATGGCACTCACTCTAGCCTGGGCAACAAAGTGAGACTCTGTCTCAAATAAATAAATAAAG
TATACAGTTCAGGCCGGGCGCGGTGGCTCACGCCTGTAATCCTAGCACTCTGGGAGGCCG
AGAAGGGCAGAGTTTGAAACCAGCCTGAGCCAAGAGCAAGACCCCGTCTATACTATAAGT
AGAAAGATGTTAATTGGCCAATTAATATATATAGAAAAAAAAATTAGCCGGGCATGGTGG
CACATGCCTGTAGTCCCAGCTACTTGGGAGGCTGAGGCAGGAGGATTGCTTGAGCCCAGG
AATTTGAGGTTGCTGTGAGCTGGGCTGACGCCACGGTACTCACTGTAGCCTGGGCAACGA
AGTGAGACTCAGTCTCAAAAATAAATAAATAAAATATACAGTTCATATCAGTGATATTGT
AAAAATAAATGTCTGAACATGAATACCATATCGATTTCAGTATTTAACTGAGATTAAGAA
AAAGAAAAAAACAAATATAAAGTATACAGTTCAGTGGTTTCTAGTATATTCACAAAGTTG
TCCAAACATTATCACAATCTAATTTTAGAACATTTCATTACCCTGAAAAGAAACCCCATA
CACAATGAGTATTTTGTAGCCATTTTTAAAAATGAGATACTTCTCCCTGTATTTCAATGG
AATTATATTCATGATGGGCAAAAAGGTATGTTGTAAAAAATATATAACATATTATCCCAT
TTATTTATAAAATTATATATGCACATATATACATGTATTCATTTATATAATTATGTATTG
TGTTTGCATATAGTAAATACTATCTGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved