Microcebus_murinus Locus Mono:192:SNORA38
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:192:SNORA38
Microcebus_murinus
Mono:192:SNORA38
GeneScaffold_1100
SNORA38
1001..1130
2130
TTCCGCTTTTCATTCTACAAACATAAGGGGGCGACTTTAAATATTATATGGAGGAAATA
AAATATGAATAAAGAAATATTCAAACTAGGTCTTTATGGAATAGTAAATGCAACGCCTTT
TCCAAGTCTTTCTCCTAATTGTGTCTTGAATATTGAGGCTGCATCTCTTTAGTTTTTATG
GCTATATTCACCTCTGTAGGATTATGTTTGGCAAAGAATCGTGAGCACAAACCCACTATG
GCTCTTGGCCCCGAGCTGCTGATAGCTGGGAAGTGTGTCTCAAGTAATCTACTACAAATA
ATGAAAAATTGAAGTTTGTCAATGATTTATTATACAGCATATAAGCAGACTATTTCAAGG
TTATTACCATAAGGAAACCTCTGGTTCACCTGAAATCCAATTTGATTTGACTTCCTTTTC
CTCTCTTTTGGACCACAGATCCCCAGAGTTGAATTAATTCTACTCTGTAGTGTGTGGTAC
ACTCATGGGTCTGTAAAAAGTCCCTCTACAATTTTATCATTGTTTTCCCTCCTACTTCCT
GATCTCCACTCTTATTCCCTCTCCTCTAGACCCCCTCACTCCTGTCTTTATTTAGACTTA
TGAATATCCTTGAATAATTTATGATATTGCTTTGTGTGCACATGTTTAATTTACAAAAGG
CAATGGGCTATACATCGCACTCTCTTTCTTACTTTTTCCATTCAACTCTGTTTTTGGAAT
CCATCCTTTCTGTTGCATTTCAGTCTAATTATTACTCCTGTCTGCTTTGCATCTTACACT
GCTTCATACAGTGCCCAAGTGATGAGCACCTTGGTGGACTCAAGTTCCTTGCTACCATCA
AAAATGGCGCTGCAAGGAGCCCCCGCAGGGATGTCCCCTCACAGATCTGTGCAAGCCTGT
CTCTGGGCCACACGAGGAGTGGGAGTGCAGACAGCTAGGGCATAACAAACACTCCCTCCA
GCAATGCCAGAGGGCTCTCTTTTCCTCAAGCATCCCTTTCACCCTCCTACAAAGGCATGT
CTGTGGTTCCTCATCTTTGGACATGTAAGAGTCGGAGGCAAAGAAACGTGGAATTGGAGA
AGTCTGGGCCAGCTTGCTCCCCGCAGGCTCAAGATCAACCATCCCACATGCAAAAGAGAA
AAAGTAAAAAAGAAAAAAGAAAAAAAAAGCATTCCTTTCAGCATTTGATATGAATAAGAT
TTCCAATTTTCGTCAACCTAATTATTTTAAAGTGGATGGTGTTGTAATTTAAATTTTCCT
TTTTCTGATTACCAGTGAAGTATCTCTTCATATGCTTATTAGCAACTTGGGTTTCTCCTT
CTGTAAAGTGCCTATAGGCTTTTGCCCACATTTTTCCTATGTGAGTTTCCTATCTTTTTC
TTGCCAATCTGCAGGAGTTCTTTGGGGCATTATTTCTTTATTGATTTTAGACACTGCAAA
CATCTTTCTCAATGCCATCGGTCAGGTAGGTTAACAGTTTTGAACTGAAATCTTTAATTT
TGAGGTAGTCATACCCATCAATTTCCCCCTGTGGTTTCTGTTGTCTGGGTCTTGGTTAAG
GAATGTGCTCCAAACTCCAGAGCCACAAAGATATACTCCTACCTGCGCTTCTGTAAGATT
TATGTCTTTTCCTTCATAGTTAGGTCCTTAATCCATCTGAAATTCATTTGTGTATATGTT
GAGAGGCAGGAATCCAACTTTATTTGTTTCTATAGTGAGTCAGTTTCCCCATCACTGTCC
ACTAAATGATCCAGCTTCTTCTCATTGACTGTGAAGCAGTTCTGTCCTGTGCCGGTTTCC
CGTGGATACAGGACTGGGTGTCTGCGCTTGTGTTATATGTTTTTGGTCAGTTTGCTTATT
CCTGCATTGCTACCCCACAGTTGTATTATGGTAGTTTTTAAATATGTCTTAGCCTAGCAA
TCCCCAACCTTTTTGGCACCAGGGACTGGTTTTATGCAAGACAATTTTTCCATGGATCGG
AAGTTGGGGGAAGGATGGTTTAAGGATGATTCAAGCACATTACATTTATTGTGCACTTTA
TTTCTATTATTATTACATTGTAATATATAATGAAACAATCATACAACCACCACAGTGCAG
AATCAATGGGGGCCCTGAGCTTGTTTTCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved