Microcebus_murinus Locus Mono:21:SNORD113
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:21:SNORD113
Microcebus_murinus
Mono:21:SNORD113
scaffold_85406
SNORD113
1001..1072
1760
TAAACAGGCCTACTTGAGGTGTAATTCGTTGAGTGTAGTCAAATAAGTATTATTAATAT
TAATGCTTGCAATAAAACGAGTATAATTATTAATCTGAAGTAAAATCTTCTTTTACATGG
AGCCTATTAGTATCTTAGTTAAGAGACAATTTTTTTTTAATTTTTTTTTTAATTCGTGGT
TTATTGGTTTTTTTTTTTTAATTAAGAAAAGGGAAGGTGTTTGCATCAGCTAGTAATCTA
TTATATAACTGTTTACTTACTAGTTGCTTATATAGGCAGATATTTGTAATCAGAGTTCGT
ATTCTTGGGTTAGGTAGCAGACTCAATAGTACTTATTAGATTATTTAAAACTAGAAGTTC
AATATAGGGCTAATAAAAATTGTATTTTTGAGCAATTCTTTTATTAGTCTAGTTCTGCTT
GACCATTAAAAAGACCTAAATCTATTTTAAATCTACTTTTTCCTTCCCAGAGTGAACGCA
AGACAGTTGATTTAGTCATTCAGTAAAGAGTGTTATCCTGAATAAGGGGCGTAGACACTA
ATATAAGTAAGTCCTTTATTTCATGTTCTTGTTTTGAATGGTTGCTAAAGGTCTATATGC
ATAAAATAAATAAAACACTCCAAGCACGGACCAGTGATGGGAATGTGTTATGAACCACAA
ACTATATTTAACCTAAATTAGCACAACTGAGGTAATTTTAAAAGAAGTTATTTAACTTAC
TCTCAGAGCAGCGTGTTACTATTCTTTATCTTATGCCGTGGTTGATTTGCACATTCCCAT
ACGGGCGGAGATCCTGGCTGGGTCTTTCGGGGCCGCCCGGGAGACCGCTGCTTGCTTGGT
GAGTGTTTCAGAAGTGATAGAAGACGGTGGTTTCATTATTTTTCATTGAACCACCTTTGA
CAAGAGCCTAAAATTCCATGCTCTTGTTTTTGAGCTTTTATGATCATGTTATTTGTGAAT
TGATAAATCAATCAATAAATGAAAAAAAAAAAAGTTCATCATGGGCCAATGATGAATAGC
ATGGGGTTTCTGAAACAATTTTGATTAAACCCGTCTGCAATTCTGAGGGCCATTATAACA
AATAAAAGACACCTCATTATTCTTCATGGGAAATGAGTATACAGAACCCTGTTTCAGGGG
CCTTTGTGGTTTGAGGGTATGAATTACATTATTATAATAAAATTAGCCCATGAATAAAGA
ATTATGCCAGTGAGTGAAGAATAAGAAAGATATGCATACACTTATATTTTAAGGCATGTA
ATTAAACATGGATTATTATTAAGACGATTTTGAGATTTTTAGTCCCAATAAATTAGTAGT
CCAGGTTCTTATCGCTTTGGCAAGGAACATATGGTCATCTGTACACAGGACTGAATGTAT
TTTTGTTCTCTGTTGAGGCAGGTTGCATATTGATTATTTCATTAAGGAAAAGGATACATT
TACATAAATAAATAGTTGATTGAATAATTATGTAATTGAGAGATAGCTTGGAGCAATGAT
GAGACTTTTATACAGCCACACTTACAATTAATGTTATCTTTTTATGCAATTATATCTAAG
CAAACAAACATTAAACAAACCAGGTTGCTTACTAGATTCAACAGTGTTCATTATATTCTT
TAAAACAAAAAAGTTATGTTAGTTAATAAAGAGAAAGTAGTACTCTCTCTTCCCAAGTGT
TCAGGATGGGGCACAAACCAAGGCTTACTGCGTTAATTGATTACTACAGAGCTAGGGTTC
ATTGAAAACGGCTAAATGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved