Microcebus_murinus Locus Mono:96:SNORD26
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:96:SNORD26
Microcebus_murinus
Mono:96:SNORD26
scaffold_23959
SNORD26
1001..1070
2070
TAAAAAATAGTGTTTTCACACTATCTCTTTTAGCCAAAACTAGTGCTAAACACAATAAA
GATGGCTTAGTTATACTAATATAGAGTACTAGGGAAAATAAATTTACTCATCAAAATTCC
CTTTAAAAATGGTAGATTTCTTTAGCATTCTGAGGTAAAAATGATGGGATTGCAAATGTA
GTGCTGTGATTATATTCCATAATAACATGAGCTTTTAGACCCATGGCTTTATAAAAAAAA
TAAGGACCCAAAGTAAGTAAGATCTTTTACTTAGCAAACTAGTACAGAAATACTGAAACA
AGCTTTTCACAAATATATTTACCCTTACTATATTCAATGTAGCCTTGTCTTCTCTGCTGT
ATTTCACTTTTTAAAATTTTTATTTATTTTTAATTTTTTTTTTTTTTTTTGAGACAGAGT
CTTACTCTGTTGCCTGAGCTACAGTGCAGTGGCATTATCATAGCTCACTTCAACCTTAAA
CTCCTGAGCTCAGGCAAATCTCCTGGCGCAACCTCCGAAATAGCTGGGTCTGCAGGTGTG
TGCCATTATGCCTGGCTAATTTTTCTTTCTTTCTTTCTTTTTTTTTTTTTTTAGAAATTT
TGTCTTGCTATGTTGCCCAGGCTAATCATGAACTCCTGGCCTCAAGCGATCCTCCTGACT
TGTCCTCCCAAAGTGCTGGGGTTATAGGTGTGAGCCACATCACCCAGCTCTAGTTCACAT
TTTTAAAAAATTGCTGCCACAACCCATTGAATCAGTTTTTTTTTTTTGGGGGGGGGGAAC
CAATTAATGGATCATGATGACCTACACTTTGAAAGGCACAATTATGAGCAACACTTATTA
AGAAAACAGTAATACTTCATTTCTTTTCTACATTAATGTCTAAGGAATTTTCTGGATAAC
TGAAACTTAACTCTTTAAACACCAAAAAGTTTTCAATGGTAATGGTATATGGAGAGATTT
CTGAAATATTAATGCTTTTCCATTTAAAAAAAGAATGTACACTATGGGGATGATTTTAAG
AATTGAACTCTTTCTGATGGATTAGTAGAGAAAACACAAATTCTGAGTAGCACTGTGAGA
AAAAAATTAAAAGAAGAAAAAAAGAACACACAGAGTCTGTGTAATTTAACCTTCAGTTGA
TGATAAAGAGGCATTGTTTCAATTTTGTACTCTGTCATAATCTAGAAATGCCCTAAAGAG
ATACTTGAGTATTTTCCCTCTAGCTTAAACCATTACAGCTTATCTTTTTTTAAATGTATT
TATTTATTTATTTATTTTATTATTATTTATTTTTGAGACAGAGTCTTGCTTTGTTGCCCA
GGCTAGAGTGAGTGCCATGGCATCAGCCTAGCTCACAGCAACCTCAAACTCCTGGGCTCA
AGCAATTCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGGCATGCGCCACCATGCCCGG
CTAATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved