Microcebus_murinus Locus Mono:172:SNORA3
snOPY snoRNA Orthological Gene Database
Microcebus_murinus Mono:172:SNORA3
Microcebus_murinus
Mono:172:SNORA3
GeneScaffold_4255
SNORA3
1001..1126
2126
ACCAGCCTGAACAAGAGTGAGACCCTGTCTCTACTATAAATAGAAAGAAATTAATTGGC
CAACTAATATATATATAGAAAAACTTAGCTGGGCATGGTGGCACATGCCTGTAGTCCCAG
CTACTCAGGAGGCTGAGGCAGTAGGATTGCTTGAGCCCAGGGGTTTGAGGTTGCTATGAG
CTAGGCTGATGCCACAGCACTCACTCTAGCTTGGGCAACAAAGCGAGACTCTGTCTCAAA
AAAAAAGAAATTTATGTTCTGAAAAGCAAATAGTACAAAATAAATGACCCTAATACATTC
ACTTTTGTAGATTTCAAAAATGTTTTTTAACTGATTCATTAAATTGAACTTTTTCACATA
GAATATGAGAACTTGCTTTTTTATCTGTTCTGTTTATTATCTGGAAGTTCTCTGTACTAA
AACTGGTCTCCTAATCATTTTATGAAGCAAAAAATTGTTCACTAAAACTCTAACGAGAGA
AAAGAAACACTGTGAGATACAAAACACCACAAAAGAAAAAGTGCATTCAAAATCACTGAA
ATCTTGTCTGGAGTCAGACTCTCAGAGTTAGAATGACAGCACAGCCAAACTAAAGTATGA
AAAATAATATTCTCACTCACAGTAGTAGTGATCTTCAGAAACAATTTTAATGAAACAAAT
TGGAAGGAAATTATTAACTTTACCTTCATTTCCAAGTAAGGTGGATCACTTTCCAATTCT
GCTTTGTCTTTGGCCAATCTGGCTTTTCGTTCTTCAATAAATTCATCCAAATTATCAGCC
ATTTTGCAGATTCTTTAAAAAAAATATTCAATGAGCACAACTATATCATAGTATTGTTAG
CCTAATTATTAACATTCACACTTAAACCACATATTTAGTATTCGATCTCACCAAATTGAG
AACTTCAAACTTAAGCTTGATCATAAATATGCTTGCCTACTTTCCCAATTCCCCTAAAAA
CCTACAACATACTTTAAAATACCTGAAAAGAAATAAAAACAATCGAGGCTAGAGTCATGC
TTGGGTATTGGTTATTGCCTTAGTGTGTTACAGTCCTTGAAGACTAACTGCTGACCCTAT
TCACTGGCTATGGTCCTCATGGCACAGTCACCAGGTTAGTAACATCCTTCAAATTGACCT
ATGCAACTGTCAGACTCAGTTATATCCACAATTTAAGGAATGATAGGTTTTGACTAGTTC
TTTAGAAGACCTTTATTATAGGAATGTGTAGATTTTCCAGACAGTGCTGTCAAGTGAATT
TGACTCTTGGCATTGCCTCTCTCTTCCTTAGTGACTGATCTTGGTTCTATGAAATAAAGC
TAACCTTTTTTCAAAAAAAAAAAAAAACAAACTACTACTGCCACCATCTGTACATACACA
CACACCCCCAAAAAAAACCCTTTAATCCTTAAGTCAAAACACTTTTTCCCCAAAAAAAGT
TTAACTATTTGGAGACAATTTCTAACTTATAGAAAAGTTACAAGAATAAGAATACCTAGA
AAGCCTTTACTAAACGCCTATTATTAAGATTTTGGCCCACTTGCTTTATCCTTTATTTGT
GCACACAAGATCATTCTCTCCACATAAAACATAATTTTTTCTAAAATTATTCAGAGGGTA
AATTACATATATCATAGTCCTTTGCCTCTAAACTCTTCACATGTATTTCTTAAGAATAGG
GTTGTTTTCTTACACGACCTCAATATAATTATCAACTTCTGTAACATTGATGTTTTAATC
TAATCTTGTCCATATTCTAATCTTGTCAACTGACTCAACAGTAGCCTTTGTAGCATATTT
TTTCTCTTTCCAGTTCAGGATCCCATCTAGGTTAAGTATTACATACCACTGTTATGTATC
TTTAGCCTTCTTTAATTTGGAACATCATCACAATCTTTTTTGTCTTTCATGACATCAATA
GTTTTTAATATAATCTATCTACTACTGACCTTTTTTTAATGAAACATTCTTCACCTGGGG
TTTGCCTGATGTATCTTCATGACTAAACTTAGGCTAAACATTCTCAGCAGAAATACTACT
TAGGTGACATTGTGTCTTTCTCAAGGTGTCCCCAATAAAGGCACATGATATCCACCTGCT
CCTCATTACTGATGTTATTTTTAATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved